JFIF,,Adobed&Photoshop 3.08BIM1Z%GZ%G01 Starship structure8BIM%m1b RPP8BIM: printOutputPstSboolInteenumInteImg printSixteenBitbool printerNameTEXTEPSON SC-P400 SeriesprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIM9 02 nullboundsObjcRct1Top longLeftlongBtomlong RghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong RghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Qg 5 Adobe_CMAdobed            g" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?zzNVC\Ud۝]ޝbh^adj1uEtepɽ̍{u~돫?Zw֞1^zGMcQywꯨba%>~Η{kEğꍪ땱eۅɭ1/vXX-uNUӦAdUg_cجb}fcc9q$p[[ݏIO{KXuDNk;K(kZ[!H 󋿯/K:^"OLɫ2moqtϪG1ŝ>js^K2ڋW5c,Bp$edMhN׷ ۈVGF6&o"7[kk+gvE>ٗ[}Eޝ{Xuz=*Ϸ2^N,?JgOЅGPzx9g@qcm-D]]F}?jGMcv`sX7+gM[ەOPs=+2ڷ4edocW:G?aPnAʽWCdzm}?6VY+jy1~"zT4},WAa-aӮg5w\?\+]n @E1&~oȯGI+MxiYhUlnǹ$Oi,C JRI*Sd))OHa,v=\Xdznϱ5شmqƶvc)/TomŸ {leN'=xZ}72*ئ7 e§8׺}-Ĕ-*\7Kc.{~_ͷ쿞 8c[E2دдWnW[[Ӻw^jk:A> >^2^8^;ڒ.84maemǷw?b:>@M49U¿gW_Gt.l kakysV}?XʯUKC ˬeO" pOszşcɲvo讲5a 2mxcK{ͮţwVEu0Rnsp';=_>ٌ7N; , ^E_O2M$m@y<S+3\"w4v=+q%i[M!}d!u6W{s,h2++w}Sztkek'ssj۵okV{kpuXX \絿v z?=;~MEEw4=][*m+==/Zʮ>/l鵎nF/mNC]UچtU`8QܶKXit:?gie-EWVָ[MٴeU,ȫVWծX~EpnANߙ! zzʵq*E /CI sZ uAOLȭt5[g9mmۨBzGû2+[c|q-;ew"IRHrѯ13FM} ~2K}c~XNim`;M.e5ՖY k@'mmmw}՟NĿk(M`hUWW ]iL 2|\<"OQ9]c]-ٯ2[[S5Zgeufmmr@.%:˙%,&RNWGds?ud3uWKXa ^7}`Ϩ ?lq$MVZל]g$X_4㴰SK+mޛtk57or?3bQyūuo7zo*9o'>?dP۔TECۼ} Z:R6' y/.ّe7}S?ѿJsr5fCtݣ&r}/Sg}_*PvSϪq:K-ƻVMƙUu#:7_ZZr6C6JL>u 9l/DC,avɶmE?S*Q$1MhϹI"̱{VYm{~30ZmY_:Qjet,}ǾV[Xvv g@MV>kK5&*-_G?AV~GT{nUחnj{=6~V~#̦lq4:DmmIONW 2,]Euw[Yu{c2]SߣWgSbn9>m ݵ߸%HA?7efcZG95k{6_581{6e]ӂS];к2]e--_eB߮]K !e4n5Զͦ}V{m5%ڴ6QY!ű3wV>Uc0nͮ6*7[?jʸK\v٘Ή+c{k|?7x_LNquNx-%6(>umfMaXF\ݷYfAANd7_?fb } kA-=jb7̊l{`cFι[벾Sݖ!]9ݿn{ |d{۷smRFџCX9Àk7k,b5]}anvo'mri8c8w.*S]k^>S5h,e]S[ nt:PhͰ5㖸=V5 l>6丳6lcֵ3+۞ߵ<5ْQg EWo}bdVj61cd?#ک͖94kQi$N:L=ic*9 7:lWea?Av=M{_[;o˪[l$af1ޝ󞿤7r/mZ 7SoӮ6WOSVnkRݤ?s!ݵٳA:;-ý uClsmEhime8no;>>_L(ƥq 6Dc&6l.QCl[Oeq2H6P,!Zݍ^To6/Ϸ-.UfX۽mg1}sZ/}ǾˍaWU/t;+sUc*e369^{⛈Ckaۮw{~'O~;h9^UXo}sr7~vXkT _wH$/Kjf?P^="lfvQOfu<,59VƋs sl{'uo{l:^Ev?Uۻ=0\کsmnsGuIMGu#~-ϪیLWY.G5?K :xnUSînݿۉY4VBXXEov>ϑ_}/ zI3}uW![n^],۸@.N׾k/5,L>c=l^ǹնC[ml=U+kԋ[@cmyw{}g"Jod܆zg¯k=R74;[~k]?PQ}ֱ`·1~gOFKE=EicZ!]s[z{FgLwչ!fS"ĔV:bHZA"4nCP .o1,h;.tkuwum s3)pOOhnEaeȂyͱ͠:Hqɳ"a3s^R\ivhdž/G/ ͭfu:>tt=6 -`ͭ2~16gPef+Vd1_ϥ2)/}RM-6 #3n{?=VїVcs-kdAkx6}?Y!w VcmUkK/o(ekI{l-{'i;j|v1dW]n9;"tk["֫F05I/2#*Эx~9-il.z=+ +hks}N]onAuT}{oh6Q5G4~w)uήo6s,ߙ6YE]~,1ܽ|}ޒsf)m,m^ښSҽޮo@>eÊ?wc0׎v{+,ml{V6wSz{ЙҪǽ _ekMy8ysX*ykV{ϳb}?\V縸αަOOQ5z {3:U0 h{v8Uo#囟ge;^E5og-߿B'&˛khndY%Ѫ )o67}ͱqo$ҧwwOi):oZ*nM9Ki}.C-??&BJjWѾduֆ9{ve;g=?¬^fJ{u#>c!Ư曱ەl~[H{p1s]`}8swg?qq$[%՛_Y`vǻwFoMN7Y^38kr[P柿E.a$T/{ٴn1]o=\7)Xt:=1c6G:{?G.M$Qd2i Z]5]>^mOXڀV {.J{ Kɱ.,5RCrY:̋9S̡ٕ10ή.p]{?EUOپ?D$ebl2M@!cOwԯl{AI%?8BIM!UAdobe PhotoshopAdobe Photoshop CS68BIMExifMM* '(1 2ևi$,,Adobe Photoshop CS6 (Macintosh)2016:06:09 17:42:540221נ rz(5,, Adobe_CMAdobed            g" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?zzNVC\Ud۝]ޝbh^adj1uEtepɽ̍{u~돫?Zw֞1^zGMcQywꯨba%>~Η{kEğꍪ땱eۅɭ1/vXX-uNUӦAdUg_cجb}fcc9q$p[[ݏIO{KXuDNk;K(kZ[!H 󋿯/K:^"OLɫ2moqtϪG1ŝ>js^K2ڋW5c,Bp$edMhN׷ ۈVGF6&o"7[kk+gvE>ٗ[}Eޝ{Xuz=*Ϸ2^N,?JgOЅGPzx9g@qcm-D]]F}?jGMcv`sX7+gM[ەOPs=+2ڷ4edocW:G?aPnAʽWCdzm}?6VY+jy1~"zT4},WAa-aӮg5w\?\+]n @E1&~oȯGI+MxiYhUlnǹ$Oi,C JRI*Sd))OHa,v=\Xdznϱ5شmqƶvc)/TomŸ {leN'=xZ}72*ئ7 e§8׺}-Ĕ-*\7Kc.{~_ͷ쿞 8c[E2دдWnW[[Ӻw^jk:A> >^2^8^;ڒ.84maemǷw?b:>@M49U¿gW_Gt.l kakysV}?XʯUKC ˬeO" pOszşcɲvo讲5a 2mxcK{ͮţwVEu0Rnsp';=_>ٌ7N; , ^E_O2M$m@y<S+3\"w4v=+q%i[M!}d!u6W{s,h2++w}Sztkek'ssj۵okV{kpuXX \絿v z?=;~MEEw4=][*m+==/Zʮ>/l鵎nF/mNC]UچtU`8QܶKXit:?gie-EWVָ[MٴeU,ȫVWծX~EpnANߙ! zzʵq*E /CI sZ uAOLȭt5[g9mmۨBzGû2+[c|q-;ew"IRHrѯ13FM} ~2K}c~XNim`;M.e5ՖY k@'mmmw}՟NĿk(M`hUWW ]iL 2|\<"OQ9]c]-ٯ2[[S5Zgeufmmr@.%:˙%,&RNWGds?ud3uWKXa ^7}`Ϩ ?lq$MVZל]g$X_4㴰SK+mޛtk57or?3bQyūuo7zo*9o'>?dP۔TECۼ} Z:R6' y/.ّe7}S?ѿJsr5fCtݣ&r}/Sg}_*PvSϪq:K-ƻVMƙUu#:7_ZZr6C6JL>u 9l/DC,avɶmE?S*Q$1MhϹI"̱{VYm{~30ZmY_:Qjet,}ǾV[Xvv g@MV>kK5&*-_G?AV~GT{nUחnj{=6~V~#̦lq4:DmmIONW 2,]Euw[Yu{c2]SߣWgSbn9>m ݵ߸%HA?7efcZG95k{6_581{6e]ӂS];к2]e--_eB߮]K !e4n5Զͦ}V{m5%ڴ6QY!ű3wV>Uc0nͮ6*7[?jʸK\v٘Ή+c{k|?7x_LNquNx-%6(>umfMaXF\ݷYfAANd7_?fb } kA-=jb7̊l{`cFι[벾Sݖ!]9ݿn{ |d{۷smRFџCX9Àk7k,b5]}anvo'mri8c8w.*S]k^>S5h,e]S[ nt:PhͰ5㖸=V5 l>6丳6lcֵ3+۞ߵ<5ْQg EWo}bdVj61cd?#ک͖94kQi$N:L=ic*9 7:lWea?Av=M{_[;o˪[l$af1ޝ󞿤7r/mZ 7SoӮ6WOSVnkRݤ?s!ݵٳA:;-ý uClsmEhime8no;>>_L(ƥq 6Dc&6l.QCl[Oeq2H6P,!Zݍ^To6/Ϸ-.UfX۽mg1}sZ/}ǾˍaWU/t;+sUc*e369^{⛈Ckaۮw{~'O~;h9^UXo}sr7~vXkT _wH$/Kjf?P^="lfvQOfu<,59VƋs sl{'uo{l:^Ev?Uۻ=0\کsmnsGuIMGu#~-ϪیLWY.G5?K :xnUSînݿۉY4VBXXEov>ϑ_}/ zI3}uW![n^],۸@.N׾k/5,L>c=l^ǹնC[ml=U+kԋ[@cmyw{}g"Jod܆zg¯k=R74;[~k]?PQ}ֱ`·1~gOFKE=EicZ!]s[z{FgLwչ!fS"ĔV:bHZA"4nCP .o1,h;.tkuwum s3)pOOhnEaeȂyͱ͠:Hqɳ"a3s^R\ivhdž/G/ ͭfu:>tt=6 -`ͭ2~16gPef+Vd1_ϥ2)/}RM-6 #3n{?=VїVcs-kdAkx6}?Y!w VcmUkK/o(ekI{l-{'i;j|v1dW]n9;"tk["֫F05I/2#*Эx~9-il.z=+ +hks}N]onAuT}{oh6Q5G4~w)uήo6s,ߙ6YE]~,1ܽ|}ޒsf)m,m^ښSҽޮo@>eÊ?wc0׎v{+,ml{V6wSz{ЙҪǽ _ekMy8ysX*ykV{ϳb}?\V縸αަOOQ5z {3:U0 h{v8Uo#囟ge;^E5og-߿B'&˛khndY%Ѫ )o67}ͱqo$ҧwwOi):oZ*nM9Ki}.C-??&BJjWѾduֆ9{ve;g=?¬^fJ{u#>c!Ư曱ەl~[H{p1s]`}8swg?qq$[%՛_Y`vǻwFoMN7Y^38kr[P柿E.a$T/{ٴn1]o=\7)Xt:=1c6G:{?G.M$Qd2i Z]5]>^mOXڀV {.J{ Kɱ.,5RCrY:̋9S̡ٕ10ή.p]{?EUOپ?D$ebl2M@!cOwԯl{AI%?ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^ICC_PROFILE 4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաICC_PROFILE աաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ICC_PROFILE ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%ICC_PROFILE $ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqponICC_PROFILE %m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2ICC_PROFILE ;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{lICC_PROFILE \M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ 01 Starship structure C     C   p"" s#!1"AQ#2aqB 3R$W467UVbrsuv%8CS59tDT&'Gcdf(EHeM!1AQ"aq2R3B#CSTbr4DUt56s%&Ed‚?Ge%^7?G"(KJRLSPdK FZe)+FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmI7?G7?Gtˠj]Otk4nQmI7?G7?GF>tnQmI7?G7?G4ˠj]Otk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmF9q3?X/QȺhSmS;?Đsٻ"v݌jQ{U9,gXO{}F;u.hO?X/G?X/TiBKy}F4I?HcHce5.57Ҷ$#ŏ#ŏi@Ժכh>J4o?o?Ѧ]R{^nQp+hO?X/G?X/Ft Ky}F4I?HcHce5.57ҷI?HcHcNt Ky}F4I?HcHcFt Ky}F4I?HcHce5.57Ҷ$#ŏ#ŏi@Ժכh>J4o?o?Ѧ]R{^nQp+hO?X/G?X/Ft Ky}F4I?HcHce5.57Ҷ$#ŏ#ŏi@Ժכh>J4o?o?Ѧ]R{^nQp+hO?X/G?X/Ft Ky}F4I?HcHce5.57Ҷ$#ŏ#ŏi@Ժכh>J4o?o?Ѧ]R{^nQp+hO?X/G?X/Ft Ky}F4I?HcHce5.57R'9gM3Q{{N."JZE5I$p_:JmDc=;i-R=$DhAVA~v[s M~^7AJO#ƼmCG7Fbz?bzL]Lk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^"L=C2VvԸA[g594iI 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣX>Q[:Y@ܷXBR='?3FFbz]ञ?B5.^nQ:'p1_Fbz?bz2Pѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FVѤ}X^}X^2Spi[Fbz?bz4ˠj]Otk4nQmI7?G7?G.u=ѯ7Ѹ}Fi'@o,@o,LF>FV+)?RwKHc3:uPPnKq۵$ʔb+$v5BM/<؟ѱ?ѯtio-/`sK'=h'LzlOGh؟׺47疗 Oz?MCޞ4vOa=6'4lOGkd`sK'?oOm;I'06'52MCޏyiP7iC͉hF??oG٭)&Œoa 18%) +`sK'?oNumT-ԕJlnG>pyp~֛5AWԸio_M;6'4f-mSΥmӌ6'z<t9ɥ4Us Hx8s'm7?MCޏyiP7:DT2R̦j# ݂G:JS|U p2D[UtvOd}؟ѱ?ѧ :}t;Szj(KDM9H۸xzI3lV#n4 N̄dQ7疗 Oz?MCޞR$5 qlen}I<߮eVȄTa 2[ ,>;I'1U,_mwb?F4FɕB~| h)W)H$ )ƹZGMVU^2wO2rHrG[Z_1?7疗 Ozw|W"|%0Ja.y;~y9ҖjpB]I[dlg%>@0~;I'2U-hQ~ߪECٍUJ؀eS#vNx].wu.3e{ĴRBy;<6?MCޏyiP7"nz2Šk4mV٭>kzo_F4Fh:}oh;Q o8'uA4c0|=o8߳n gMyiP7Z_1?bʒ* t6^|'vd:PO?{*.mHoOGh؟Ӑ4Sտʤ&'ُ6n)d`sK'?oOm;I'14ǡ4Fh{LyiP7Z_1?Gi?cb?F4FѦOT}1^4'ڊa > K?~G" x8֠?RCm*T7uMtnڝ ruO(|kT^K̩W& kzJT9#:7疗 Oz?MCޞPZB3u~,a?ѣb?Y% Rst7疗 Oz?MCޞ4vOa=6'4lOGkd`sK'?oOm;I'06'52MCޏyiP7iC͉hF??oG>2b8rF'>tF/DtqnS<ZzMN^okx= HQ y8נx94hѣU514hѣ: 4hѣFF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4k 'L\Իfڜaa42!  ӆz*5FXL]VvJ)O$p]GB~\3.: B@$*:%۫%P_D A8n(H}uAM.PD9%/, O H'I5:F¹-8QwBO p|y]>Z/ZfiVtJѧ\u4\Gԧsy+d2TKJBHW5ZzYzҺD"R*xeIDNn9ύ#F{4hѨѣFCWhKЮhVL@$Lq2LyԼLgTS?s{)oۀuN|ӲS-%/KQqJJRBIi1H##oT%6rJ2lV)MҰeDN=|=]#z4kTki*S.V?j^4U&E7,gK݋-<Ny] *RnSM6'? {49 M$̈JۦΰTlKBAX"?GM;:]'i+Z^D} mIQ G>$=ƽAu.Ei5^ֶND sZKBqBci˔z\G&e))enh*HR[Sy`= OWgFn;J Q; .51]}5҅8dZPu'&ׅ)#F8kdDE"ּ"X?<%~sm@-Et-mqJp[[iAڝqPW:d5]2rȌPcن{IC QQ*KH'w3O<~ZzQonwyc;k%më}&P*,:tiVB1iϷ:B}R-'SgT(o֛*oZc蜫VH̥K@JBaYJ RHq>x6'Vs4CtZV!ŶCp[u{OyjQ@ǝviĶn6dS9ir5Id8K Ax8BHYqg'^(xRvxYgϳZy{c |{*?W)7TZ-~6k:kUXVP1ZmꔂR\ x(g;NEnQL*i*Puи[Rb-!%RTu󷶏'jO<*^Nr$6MS؄qmGX|vԶ( e%jgRqqیRPT}']jQQ''^jĬy/ESwQNn6K ).?ڵŪdZɾJхm{U 8B $Tۺz]cL1.9FFƐ\SJT@M#xJ^ѣF4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4kTlaǟq-4*RpN_|zSFKy ^2<$sIΫ"tZYqS$|NNȢUmSU1 weK}ae;ua>z KuZF@md'V8PTđ)|k赁K@ "ӧ۳>e\B0FUگQX$ @ NZC,}4+W}T0v4SPitxQxSS!da;֠yu-l!.UJ:^jCrI>F8p\=^lERr&SOٰS R?Ealh%D! rTu?v uN]*SFM*z'+GZ|psy =SKRݠݎ#ȅ:%@G>֊X˯JXOԧ5ޗL~7/  CuntfoUݮ&U_drI{ 8*烝1R*:[*qu >!-gcAܐ}<]_)f,%74]lj>mج%c?zIH8SGS**TTR)$%$8p,8)IjtyzXش}ڇ85$6†N" ZYJe+j@ H9 tRJ1+蒢z!k \on<4)6,Ul|)%rJQuy JyaFJk/+3R‘)I/ kDHpP X;#:w~s^b*eyFT^RC$1s||he~#/Ir${$w^ON E NfAy ~9>vW,Ubϑ_F:'S:w/>V2CRQ- F Nx奮BQ*N'iIZHQ뭿6+% CKM` '8hu,=5QOR zYJ &z*wNQZr ;H#Ʀ8H -#Q<Ɩu%bؽJ/[jmE*5%)Q^P $鿣F`ѣFJc[D,z}74Fԯ5?Ii'KkW_=Mxi_WM?FF4hѠF4hѠF4Qʍ9QdKi?'5}8T5uc9S-kZř 9vp8Q1j?m0LF4&}[ mdFysk~I}҇G58/uQZuI G*h6w}==?] VƏϫc\ BRT}׽2iy# m9#G(~yoo֏aFiؗBV k[] VƏϫc\!NpӇ J'4}҇A߉_aFhoo֝FC)NFFVF.$H*k3`ok(ׄ#4)miOHӣ?Lic 7_7G0}e727 Kͩ[R] VƏϫc\_,0İRӊPt}҇A߉OaFhoo֝_2[1(YMӯx>=cy z~WXwgտ13l߱[?u˻;NdaJk~&5/uQZvwff?07;ƻ>э VƸKZp xpe cꔒ4}҇A߉_aFhoo֝BCDlzln!u`oh0LF5[X@YBce^8?P>[1(YMӰ8)7Jw ] VƏϫc\*eUH΀êӇ~?Ljc 7_7G0}eKͬэpNrӀ9AAeŵ8t}҇A߉_aFhoo֝BK$l:/m C?ѮϫcGgտ1BRNpuag 8pppƏP>[1(YMӰ @>q[Xk3`ok08:.1Jk~&5?/uQZuY##24%sxwgտ13e@ zO?]a?Ljc 7_7G0}e޶18zQ0LF4&}[Nѣ?Lhc 7_7G0}eѥϫcGgտ1>C oƏ0}ec 7_7NQ0LF5+A-ݏ5_#\-+ aFkLΛQÐ /qGgCND~z^+:^8 @?Q^'F4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF]paNͺz۩;i~>k⅟5ɫZikz'-N-Dأ]ůCdHs~5[f̬NaH)ƶ.Vx ?R|L*\T]UՔݮft⓲-LE.jP:[1aVbWiG[p;@'}#V;y5PB9d4 P“ '9Ou]x9ƔwMfjjiUIpQ1ԡ„dxR#^"դSO8tBs0MF0,EU}yeN(GH%)Z7XލśMe)PE[%:Vwgv;פ$ISeR';WOPJ2^63I',wM>0."oR/nu@DvNz0"0J R+ ^Y.W)KrKhO-ceHJu$_ 󯔐j6Tg՛ؘ!F+iǩ+8%I>Fq.=alH0k!ڎߊZ1'w LFӭ_h+nJ63AA8tUS*й*0<)ơ)}@Fu'jQ) UjߘS"> i -N H*կ>IaFӞV+=?]- !()[#QvpqәD&+B*%Y=on5TR_0R2c.^KJcRԻRkT:yL."Jm&%Gj\oYQO*Vat+rdR['i[_K!K9\gϝ/XvC)u LJfd%RdVvm"5>l§½X:y_Ɔf$U#DߖŗHlEMJv)JOpǽ~d§, mƛVI۷ FuuzչtPUyJqHBJVj.$~kהY TjTһ˄Z''vn4ߞ\&V¥3(``@~"+Rz|ٗWYi~<낊I4q]VIZ*8WhN[_ddFzjŝov:[wq9 @7z?/[t2Բ[$#؊ܚ4T+JnQQ: :L3Dw @B ϷfS w<TG5ZḋV9eR^CHZHN[U*m:=BDE)nH!M# #H52sr']]Rܮ obϹ57G>ǙtZx$VpxԮb;_ۧ%)q85ݦUz[lƬ`3}`>܏ݧe:Z&e,-+Nr?Fd$VesbS~2vaҏNΥkSdͨYnsaK  BJJIFkԊo4]ee% xƀ}IaǣYlV|q~`k-:41F1ѬO?^5(gZ^4w@tiaso@׻uF.5s'tiataYN6R9~ kfUtm|n<Z1E)>=}?q%HEJhT[$FfFJ'Q+sHu]U9:UZkBߞpWFRNR$g5fڽMk(NyQǰպu^ovoiV ̦CrBOҖWQF]GƖ6c>i6OXqZ}i`$G-b0걖J2jepcWOGL2nKa*)jt$pk5- ovhTχEWM:3\5vq*QqR/z1v[?2V2)C~:f_"ƏsխJ =Eˎ)dl V<gM +7\AL9jCs8$ (9^qp!!Ki:>3ĒgTӬƺT+v^!QێschA JAaS׬PN=H+É$saOGFǗq~>J=n5M@rt0ܣsά2\g:^bҊ!p) %E PI ƾg?hWM)qŰjMLjTOB\V(( |ujSSb uVPˉJR AHdyԁh]`EmXN(SN|n娖Zt1gTגeEZ$u;RNx#Nc&e:ܵUĈ8? [=tTF~c&gh'$~"?қݔR\ ZYY#jgM:)uI7m7:q{EFAKi [ [#χ :&IJikDOb;TVANA;RI$=v Wk7ۂOMn{׌Ӳ4H*K \gukMӚKuꀤ5GTY!( xUw8#8"URS) )Xc'!B8ԗb 0v{rw+*Gx y:gGC*mQZ KrRxկv]7OU#4Z8EBJJ7!KObIQRA )P݂ T7gUw}~26%M5*HILmIJ{*$cw!>F8EI=BߪUkoeR-.U5hl-;Aptd`ǝ.>j=jK4$6Nr_Z+ fQ + y)Ry#<~^˵.[hR9  F&ґ镦dT.B}͏P(VNr0r25ND:u2G[jzP++ʧ }۴T)r|7zhBSb}oWjajA9ڴ+i Bqu;ȴ@m;Oe%;nJܢy5eu~Rrt)i"#0 i0l/rpvpu6P_.SYJ" J1Eq1-G#MR82#!\* 5!y#i+.In˫."| H =λs^ՋQɄv$lFR\ A% !#$dg@4hѬ4j%\4[ MN1,twd=Wh<VthFrC$x?&U*B-ғ/^ fե?[N h1ؕ-X@)QYϏ}##R s)SO5_ l?W*jKT(ێsR' λ5oX#:JJ+}/GGU8:U}tۋ"GC@7)K4'ԟ~e{fm)ȳX zF8WzW,i. wT#G s)S0Wduz?WduzU ~#/$!oS]?h@7)K57+ֿ7c2cGrksv?+4DN݅;]9vF_+?:+?:}?É? kM XZݏ?ӟaNhDN݅; λ5oG λ5oF{b?B5c|CrsSrksv?+4+ֿ7c2cOAtS?ӟaNi# # W>#/$!oS]?h@7)K57+ֿ7c2cGrksv?+4DN݅;]9vF_+?:+?:}?É? kM XZݏ?ӟaNhDN݅; λ5oG λ5oQ^؏#8>!MwX9ܦ,Zݏ XԉJlxqn{d8i;)$4#q'y߈kVI~S>nkJnçRSԤgڏB [':u浤ewoWʵOR\,i$k8pvrt ^wL:d:5eS+mo Z}G'?ѯ-&#FZ4hѣF4hѣF@$mT}MRiJ#9'TVZbDFK7$Hܬ[}LCmJNzV#fj+ Kua Σˁzjh@ys-rݗ[P  =Ԥ(dqN(zҹ߮ #84TP)W̮{lծje*>KiSRH:t/kz z&P- )a[@:g~FmRGuMtR%aGB'Helt%*~ѮS5ɩGZ zK4Cr$Ro  As9ۨtn\((@=oa%Yi9*'h#G?o>Ffiui_ԚAEen1HR@9#ѻۅné|-]l)8HqܷKA;C'b $<?-T.طz-MN+jCVeJ#,jkX>\оVNdTQg3C!*uJJIkb%3kfߴb %'rIAOnڬ׫iܴFRF62I FN5Ss*]F[Ԯ2)N>ːa% rA**A֤=ʂ1õ{.# @>UmfvQQaHu`#r$cJ! D4SR^o894ź^0#B+v|xkJzI`lNZVM&Oؑށ&2#> ;Jd:g=zru^Du*qZLވ‹R@B:5VNOCNԴ=IWiH;fџ$SIi6#\*t𨅈v U4Ղ.0CIv&s۵\x4*d$2.b4ԧP*B$4¨E&`!MTW`O?&sMBWc$<9{LO6j]k56aŸj)h%́JwMr@tb_5. :MqjCl)m8*8S]6zh1W+nS^ۈc AV%+ Gs[_<:6L د0 9<m6 yHsڧ_*Jd8J2v땮* wBHG?s8ԯMܓhE6@⛑  Q0j"6Lsb) hdXW*qmr ^7 O-lG;+N4 rg#LnA fe֖#+ppF3t]1_,V4릙fSn%"в8=ʂVFIԸ5:!.8ɖv$Ha8\[3cJB#Û#e'8ϿFk6KR2.BJ A@jD2B"ܩKZ C#'H'qcJ(9*ȥT1wVH¶oFʻn-ؽ(2f rE!QfFظ)P A#:B:NGڴ;ɄaA-Ax>A*J'f 1Yh.:ŽWإ0D`Jz@%9%DVnק)Q`]Uv)Q1"QC? 1ιKm15B珯}G UQU$&\\g q`  q::=ЪW6.՜qd(k=,LrHz变H'8HA>}6(~5ϧT!.L*AT iP!F* C8ېCOaS)7% M+ VZ]U( WT($:Vmf>۾A/A㶼:#:@>M>rÍ+ IuSwVѵnڍ"rX }A9j -)?OR'9_M/Q+u+oI?l}=^7AWkO4ѣF-2ѣF4hѣF4hѣF4viXߤC_џ~_#y._ujAE>Dv)vkߙ5*P~AN<֒,2NlŶ>ߠ+..EJC)S+kϙ\CBA* ՍэzGJŐQ>锗23Xa >[ʆ甔6(/9bD_w PrS[ Lg8 KMs-ͭ@%e>jh5FK4*Tt!mZFBp''f׮욍o\Ċ=u)GqRR%4PT5l4h \:RlM낊AʭUZq"J;;! *Ժ@_t놗rSoRBzCHNVIܔ(UUvO^W4i(jQH3 @ ]QXJ F=_Tf]sgiuiصm6b,F+w8VFY-._֤[ϭAL[le&7% zsNT !-,, d+B >V"ee:E5i@)?x#m̂#P.Wִ}*vM܈ḧ́1 .v(S 9Bun!,UP=1Py/uVB[8OiãSNXKn@g.T^0g.0zaTNjS%=q cB1KWNptvr) jƤSXS bƜW8j΍V_p.n <-b.*)L 0S=!;n'Fsβmy tխ+k9NL(Q⭅Xq;* o5ethEhϴ+PkZJtJ)MR4q-4$v4CZVN0qmnV"PQ",QSHZ~CjH[m!%ΪUj-uλf۹Q 0J[0< sݕ'%::DyQUPƌ,1d*)GM,%Rl%'ˣFRm6j.rsMW*,o'i} PV^YcLөR{J3#&PYGLdR2w)8:[ٶ͓{HI9>\-#HG8ZǕ BFbRfl[k VKe_^'+om);0(6T{jźIaTWih(+[J0ubt`hKW,^?NqV;ӧvÌqa;<۝RwK HҥpGBm{ժ35VR0N00SC-aopZNףPOEhlS,ZuVjYnRC ()= /~嵀5ʴkҌ5Ndu!%ĄmO!Q[^ NGZ4ju5C\9NJ*f-wRR[(BYQ%rRRIb^V%;ORA:$I+ՉOq,$6poΪe:vODh)-B> w,\+ܤ6t2:W\^>ڝhrKwkEp[ʙq]SI1;* i>tKl#j;jNt#ېXGEj$嶣}#KJUj*Nu*vʶjoPꪛo=r"5%Q6ڀq'$<'6KޭqjĴgak)$S8B+ih&ő[}/.[B`bK膧-eɒ\ܧө% Lʅfh2%T 59Q1GKn6;9R}85\ftuZǶnhq-ؗ c=;]w}#,IݓO[nPfSE-K *TkqkK>ŚѣP4Y]LF.yiHf]MoeQPnsDsq3pU6Ls*$t/*PS ]tTp6C5gF&Mq 5E0nXȧ 8zwFp(ഗ3q$u;ùcv;HThIzQ#TO_Ҿ+w%+fv*)w bғ>֒%<**%$d75'LZ/x_9[#?4njAh*q8\6R:dORiQ)mTA. ]'kaU:R|*BBV1>lkN\z`tSd ~]xׯGWJr굅>&Pa$Ce1B'>3=u74;YM nvSR jK[R^ÊH9όP ,ٳ+Bi)*iVRIO#Q. G bܱ*m+dq8VE'jZP*@ƞ3]v*e"P`WAhBmL/T޴!%Sh RI8: O&A[=&h$8ϣ1Vn .=NXXύ_{[46:UFښ4څCfcVdύ}]`Q.BW[3!SSJ[BӂO <wL.rǨ8e KZKTr OR:bY5toj1MrpRB=joXQ ƛXaKk‡sGKNO'>5kzg 鷭 WPRT$)1`WDHTy9ǝ:6Z)۷KRH:}ʗĥBqH c_FM>T76V32**灦4U,ẫ󓪒^Ӎrʻu?AyjC^XpUeRQsRZi,=P8w[@)NTPg^G-:TJ,Co ﷻ{|=y%T1ys_2-O$-׈|lEn*,8nEIqF+-rkR)r<:*]+԰HD) WN9#_vHP $1Cm!! FwMzEy 2ʁ)KoGkēx%MC=RseAIH>F=ƾA)+gyiӿ,J\Ɯ*RYeXJ㇂\_f0>1/1鱜6ˮߐIXi--Ȋk!%](ehKFOuOgx ƙ𔤭%q~Sud|[)R"=Bv=3-ehF<뾹gU$OK|}MŠGX}2׺}@{DunL1 p!mmøE<|sΫ tbCO+cL0G)i/ bE\eOt([JWZzg}ݱ Ig6Dm) QDZ HRORe ;u 0J JRi `ΐ|K8I}Jjsd~'-Gc92t߸>*s5pc$O8<)DD+^`= 5_"Z^PNJ]_뵾3em#so]-WK ?ԵNZPn{j5;<3SXW*ZN ܔ:?RO\ inN>ظmK BS݄1gPmjG#mƁp%(+ӸU+͟+Uy ӓΙ!R9ǟ$ ܢNJDKWîJ3H!,֣ /&1 ˈ;j29 } +;@Ʒ-ƛړ>\+cƴr{.#׍rK0\wA|*հ>%mrl6Sq$OK`Vw$}q$X :p܋P-19H7!+A+u q|E,-Gz9W$][qC( 9T-I<#zEW٬ΦL(jj_o(ZG jѩ\bl W:{Uzk#Ҳj*!IRF1}*HPM}|{ۗNZ5I϶BNJJN; J!ZnɂPao:yV8FH|Rn=&S›ZNϮH#*w!evCQڑBrNp1Xe->7Qu.wP;fu]E]eYe))ZS'#n335ʿkS+1Nj*&+C*pBB'uM)jv qߏL?4>4hV>S눥g*h21_QnkL—el= [yINsPN7w!ۨ˱I' sUtk)5ML] ǩZteMp>,kV<t(H$v jpne΢>tRm}JLIlT[*Zl0*:Nϫxv;[%-QaBeM'}u|+vجJn:@ˎ6܊ARJTPQ/Q?*"_ JDᰐ iH|ZE Ɨ@mft@ZROYzADqǔ]Br?Co\P/k>kvǎ!A 91:a'HM (hHAVv-O# Bh&_-8@Qz{ʥ>i=)Dm22w9dHO:~u.Unȵ\y@Hъe^8ꌚŅzn7IOx6J( + wAU9,Qg'F.IJ} I4Eo Fb"_q4TS%!nJФ JuJqjIP ~Ў7MQMWzٌF.Nƙ/Cz3eMFPKcF5gU|?4oMJTC܍MFF??V{3c24?a? ?B2'٬g#w%C[!Sv}/BR4hէ 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4j:W2j5qQuNUK(G:Gש}3oL/}v]u3.OS&#5g \_!MG554hѯ ǝM4h׸׺zt]]u5 qMJʀHN~5(^Cmxc6ܷjlKM=̳gZM2^Kn%G]GPHZv:? 'fm&iP5,2-)ngHN8IU*_<49*c1[,=ՍJ֛>j5UmN M;%\MAmR#Ht|i[%昅"SKv{ | TxmPzۥZtڥQWeԩgz2qNΤb[pt xW+$i@Ȥ.u&mň5q hڄ%@$sFYaۓH";.)/4RR e>>gj2j&]e>*آFiB !(PQQί5#T-cAJ`J$s-F_* BB x\+[4A-@?;U**D QV$ j^w{-(qVP$ @W/Oh. ] ->ʤT%n-Esm)*[dq4˾$2CJr+jXY֞J$=UF D3&dñ)+!s@YNRFE~5Eز:6J(yve?8OuC^P qpgU*THRm:8i-nZi eQ&ln:R@9<$i*l9Uy$)W O'ǜ5LE"2Uy.UViiX#Q ,4ߪ1]@TUkRH>2J J] R#nr2h~"3",qTQHcH@U&{鍐7IZAHm$hCRC#{<-ة'وEjmOA3AYIKn*rbVe+i)ZԟLr8?]S*{;P*[sjf.]* Қ eko}$$ ]]ޖPR_]bl"R%ڂꐒXy8k%%Y I_N.JdjMU"IڥT]AI5^/46M i;$HDsp - % m>V[">;.)>Sѝe,Fh 2\G@ySY䡞ob &06õ .vK8<>USE뱡8)+]GRf9P/9PRp2ιg]W[j*ܡO zfuy Э|c%/j=9~G4V#\%.nkn  < T&.K.csA.ڪSVLC\T!1y'g<5 ciO+?AWmPJ}Y>烮*.PHuY}vt;HH8=hPQ#=kΰ}\2iPoHO)Xn2 P)'ՀMܸ( 2.*/>`a&SNm#)IgTa r1AB#'jxS@KsfW 6JbHB Osb 6:ԘELJZDڜ)Z 0opNFtJ] eSiܴ!0x#z1tw]5K+ݭBBRFqӄmՂHڬs2WE7iO#۶ivmcrzE͎jvuôN #b>I"I)5? 8tjj'!8*ՙ72kt[J"H(NAO:iZV< /K%KZq.HDhc^aiJAFsƭ[']j*)ATyLwp~$}@Czp>3Q|4 ҪKvי2ݨA / JJतバu !HRT8e'>"?Zw  F5ԷK>1u)׭Sq!%%F[yVr P ʒ|gΡA_Pn™> rjTP%$$q}r3Bki{JV B4ѣFf 4hѣF 4hѣF 4hNI?QfuI?ug9엘jbсVL]?Z0?5ѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFd?ìu_#~/`kɟ:5S}?tWWuWWu!??׺??׺4hѠѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF2Cu/Gt+)?RwV| ?U?k?W鬵ɫӊZO>75'LZpZ^'F_Sy[#ցk||_B~ͦZ @b5:}QlΛ*uHQ{t)B})+QiA)9$ VBhJGub3y8U>% e9Z7EjZ}ڜfn":*,w]m *#$:o ka -vnY.CkiM^P);1yƚ:eTPXuAH iĒsyI1 JM%INg%6Y5 rn*I\NSSYK`.Y$^@IuZy]*B 2.vxԧdZ׍֩u>%O͐ <*OJMb-|kuyLv[I'6 W+l]5g_&U*E[UJ|Zww! l,>O#$\)z:%W K=0*R22'84\bܡ~ԛW(PBH9>s 90)eN8 I#n9-KY&R <8:ѪzňB|ZL`p|);@}>s˷ゴ,eZܵWЪBk2+myM)$x*T~[Ն Yrbcue q(c\_jPoJ To#ب߯ YQmRo܈2Py֪uQ5;(1 9$~ H]j6m^ԇD4@}m%V500=|iR}C@zc&vSjlP>_u֣{[ѤҚ\)#TgyHj}qu(֨ԵzTwPg%D*WèC7HW!'#>SKm^pZ?y-HB;N>SB~upmal5>S Qk!կh?wy{kU)5Yit5;p\ʼuFac\8Zq2mlW&"+ډ-7%I>` ByH>5V,Q}8ݫKvY~Z#,-J a$Sà O1:ՎMT%Q)u&܅%qc3PB`(HD"kϵ>E=J՛\w^ iݿ ,cM:^jIr]wp@ pG礍zrV[ش+Ǩ24j6b{ uwvJSoGmLB#V GTCK :TI;G@vgS#X*L<>u/ɶ9<5)╫Φ-Sj+v9YHXRR?g8t.*jKv"%GOpI:}^:*.6hJPKan% ;m[ \ee}RAJHϏߧ}BŴoYh3TKqB;KOV 3\;ě[PU.{5%"_z#l%I) e>FFo^kWGTc>~@a (SyjuCT듧0kFHLe)xФ/+F^ž_MBSY>6Q'i|<|+נUje\1h*KR0;yc]~{o6Ҽy qyξʰiwOSMAT῵869S5*BM2aKiHQ'0Uoc3ᠷGzl5JN5uVn?k9E[w N1X~.E}[Jj- #wG|^u_mĚEZ)}+[B5{ܖd[ۮՂ*")jSo!)N-aKlJ[+VǍP6Kv*iY9`H<y]Gm%w"W TJL琲ѧo%t=5蕹^#'9nױnGn=a%)e.c.8NtjS}z<nIS{ %?R5J|^B|B@8 `8,*| ,*DM~t5FTm%ĺH9 sԏԮX[Ka!" *ZQʊ $0O 5Nի2iy%^ܥG`iIL;b]e{P^5*dJT)J{QhRy >^&ѷ銋NK*[2@Hr}ݫB&+3^h.mGGҌQv''_9j2,mVaU%4.#QKN+P3']^T )ڣkp@'?Lĩo4ܗ,GKqXʶmP>o'MMy6Jq5IyUuĤPn+u<G1kOjqPJMaDu6}JI<9:nWCNE]X[H@%.+f2pƺ-+F?;uDi%^F4|;1NG\jLv=LDTjt9"tzmBTxn+k#M֨4ۋuE(k=Wҍl3)4J8#J@r{TSgKR b ReHL{Y RrIxRܮ\/.INkéu#)9oxV(jbiSOGS`,~ ;Vw2togP*5JV,)R/䢾_KpT, !*Q 8! As,~ѫ#%+KXa+Bz\VAO?]FU_^*CTɏg.3cLA3ˇE3uV 7Otk]zdǒN )T\9R54^BVW @)Ρliڴ+:%gH6$UI_ # I9ۥ.2Y Om l<UJ|I{20};B7 GWRzSQd!_iB=z]"RiTtN[lq-Ĥ)%AS x^4?UU(Sa2?8Pi$WF5W9RF@k<`RD$$2`JI:CjkApw}j|Fk>;5>AL~Ta>[ނm8[J+NA’0t\\hԏ!uL{#nBg9s꿮,zVnAF@kztj vCRxYzF* T+]Zsz1Q|MЇ궛)iAd$ y΋tc~za  7ɂRCz7xPsCnF-Af6w!Ɖ)%*s=.;9 W[l4z15(³:W\1)-C(6p|;֘p dLP6 @FE.b/S(ՙ\{/J HV7 :սOeȌ9ÿxIY9UhTm3! Ugq3pBIa{m:aȞIe;>A'$ s?j:jPUiԔfqTI)wԿvܾ6餛r-򞴫L>YJJSH*Џ{j]2E~cT:{@#H\[7)v' =x@O$`UOuUWI?9A^_o ͶToS/2JQX?p"܇:"&7Ou*BN|#Wpƪ#>QRQopS DH|P_BT?I kJÃ/zs٣Fup"(wn>#l| BzZˋ?B\J9o l)'R) cAΫ-~ئ] ԶR  2}L.[5v5]U|X#bGu9GqXd1}"t bq;nNPN/p@S`$s}|0 Nn2#6*k%(p$RAx񧦍DŇJ-%׽8=#OsyH#oR~8:SZ fkp!`8**?xpq.XԈFWd?2¿WtfKRC(.-U d n?άVǟNiȎuiڐbS 0|0:,w-,CJVG/hkyF5 zVf$UKZ:6JC^@9Ɲq?oȿfH^GuU:}upFx9Ҍϊ1[ST {)y- (eDOOz65oi=>whZg8TiH7'PX[M68i[%G#- ']৲HCScۥ( qJRH i׵n,s5ogbOHl0T]PJR3Nvu.Y0ۉXa1'b2 F7gx/ڼUn )YG*k&VB$O_:%ENΉN~|C1c6\ucR9'3_Jk=9OWfS^V(t}>Ñ΢ Q,kK;:*Qu#is_kUkp)_1!)ߟ~_2S;Ӯ䠫TRһ϶ڄfGi x~0pgv" 3 o.vIzNU?3c=E.ZOc㥑ޠ%sSkYud0VHʒN1 K?{c535R4".<](rOJgΦRd:ꋄ^iɼne;A^Ɲό)Ze"m1qw2[ChATk$0ڽXHy:E.%wWn2̬OiIiok;Tlt~p)x n%<d"zXDK{N.E+xO*;8'$xZC[QѢD!2ZYDwp^c /#KOiMAQӵrTJRXNG= ruQRVF{ɽξStG,ƪT%*P-HbPqϤ$yӡ.Q+tf@y3^GSc . 8dgNU M穤˜gb~VWXbO+-AN@tȾ:k@ySI4OU%%UE,`!캵sD5Xz]Lg"ZGt٩Z4*Rejsz6 DiA`JPq*8RI~Q:Raeْii[z &&c1T[A7?NG>d .c JzjW\LvY|QdH%JWqiRQ4괱[veM;[UBOF=2-;PVVؤRQ)0ʙjLTP A[A$a*: 4ySjtӢ>) @{x󑌞4tE5k:<JʀFp1F'7iթ=3).I'UI!ED@$5"}\p8ڹ=I2T8Z '*lT* b[侐ڍE8܎ @FT0D1*PJRbEZ eNrt6 *\M:[ EMLt8A R*]"ЮS M&@OQH),@ $MY ˫Twi ݸILu(qߓ PԒJw-/%*UJ%VKj ۀҖ44>䓁1 sRe"4SU,$TpNOn4]TCTҩIo&DJ5)RRwZǭϫqlͷmQ__L:Ĉ%iSTG>GF`P6vE.s)JiCiR>J'#ջ éWq:RJ&QZ݁I嵂n$chjm`')ۃa2\J[+S&nbQRA@IZ@(?~$ ) g~!T[m\Q7 cdMWH̙MN[Z׻r}ƫZke<6y)D.8B-( }T* jTR2G ڠ<y[W"I\0C*y#~+ϋNmkLէRr&aDPte l cN/=[SgRcLZñV[ϩJ{zo=*LQEi2$U#Jz Ruҥ [6ЊrދNSOS+t%u%d-nm8H/1Ce[-{;@xSuN==`ڠI)}J0Fs4CK Qʓ)X8Ljp RJ&%SyDI-ʜQN6'<# 5&Sy!:'`Ϧ0iTA) 9>tƼ+q/A!.$X e?tI<(Z>U/K״h NQc+VI؀=ӌ-KK&)Zzp[K%$&IH@A >q YnkMx80[BÛA| {iïP)k딪k>'m}Ko%R e,M~x? VCڐ2뛇;wq6xW鉉V\}R䄬8uj蒏qtkƀ!3 jt7i7o'q9I@zg[Zu57%N/АuMzmt2MzLZs)|=Jf٫/G!]|5eVP]#fDC}ڀ}XRVĮ`St%ڡ);TU>ݕ' ԳQi{Z[tr>]NXRpTItu=jNWqo!kTv}^+>25;Q}#O)kmҊPR< )X+$v\w#5S@7dqQܺ[\TL^ҚH'n?TVXesHIJ/$it>UM@]엍Y ?{)>8E}>%~[sáu"-KPy(j>I2¸rGuJBQ"?藽p*Zj~v2@vAmm@@7X8?/>l^kߋ[Tcԩ2Qj[ ?_ou?Zjù)nH=KjJT9t> qk2ZT G%?a0cN [_笒^(uBaV13 R} θ5='+9y95C~t2׹( ςd)'I>K5uWFˬ´f+k5w,ORq”>5*ֱTW&Щ봇 6l62 FPT O!ϋNȕY:^(1 TPi$<yv9ѤKy̮+[˗w)Y;=-4JE;'i}a3SbLǷ|l;*) mr>8>F}4hNI?QfuI?ug9엘jbсVL]?Z0?5ѣF4hѣF4hѣF4hѯI'μѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѬQukDO~O4}e sU?3!]:gCNJNתJNׄ=y'^'F44hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4kѣF<ѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF2Cu/Gt+)?RwV| ?U?k?W鬵ɫӊZO>75'LZpZ^'F_Sy[#ցk||_Q(hgva)1Tʎs9#:TTw5tҹSv2rpx:yWH  IpbKCA 8) q1]sUKHU-WpieJVy{9:_ Wf>ϝ R 4%M*?B@ q)j֪Tb=", TGcWDlN Yb0.+oJSVVI88U7]xVSF>{9lm -l?Ls{0EkrS [m Tdr0T2@9*i}K`:adNshrUһ>F,lˤA~a=ͨU>91n}KEr 8ZmF-d}ΪZghrcB1qW,uMfZċGO-2%$2tݨqKV$6AR_P>OqZka௪'ӏ$m rVKVi^I*>u?\WD~3QِW^n!*N Vu~7-. LL8.EJ\<%j)=-ύ5C$USkm8Gww e{9N,U]rTb@zo'%IR|zQ)AmDvI>Q-T~b5Q` Ixϒ@hXTICML-U;/"U-I|%iwhPZRPꏐ0dn7B;@ly-p\**Zc))O 9ts:u;;T> KRFI)Ǎ[>|N¾S[pMJLy'`1\$Nv$yNqWWKr[)i-Mn%Oib R{H ŕTJ)T$0v)ROsDj3 UPpoh Ds?=5in=JӑdOE2Ax8FjXbܒgEM.E9ԴRSq@gj@r96v&u6nUNoK2,dpBT +iājOӋhn)ϲmIpu7Kmp*)32 mpUQ]jD Twnx)L#U5OgL&RKhXZ$A?~hS*ُ( R9IaDnf܍Rñ*_.ڦwޭeMKE*fЁLRIVDSLLuù8*Y$¬gZ)~Նue6LR]Ko) w)Xq=IϤ§jC#*Ny>VçIdᮭ5"@Z.`ԚL[;.5J!,-Fwc8mQʤʃt%m K $H8ڞFGFYSRRPmaaJNRH>z t^fmjLf%u>|^>0 U>.?PX#590%)p_dm ǝ}tKJk2z+Оu1P`(, Jj:ۏ:MrP6ԖC%TR qk}nѤ(p%o>8꠿cUoʵ ^o'V56+t($8H$d3]7ګ9P- -R}A>%+l ݶ̺OVq)TU88HQ?T^7;bS^Ɣ<'A C[]AA<2)֥~|@کjqr8P(m[TPPNG#9'VUg~ͤեXbwy8᧰ܴ` p@顴b4C`%21$;m2RvũPjPVNͤyj+j֙[%ڍ]ydO`pqSOM.L"={K #hVz/L.TU x$4q3]CsSHo!N8V*џu;Mo]n HO\ma:Tdz I91'wBRh)Tnc{\XI8ʔUq>/.lD%J[qiKNH>t$&J":\ R2Vj&3 vQ !­zvY*&n\uU>FQ^Ʃ#܀I(8Rr|k$h5X6l+hR8Q*gER[qk2QJTSi[Da 1a+G'P]DmJZIe+HHJGz^zwM.\Z ʧ,9 BNu\YwuV̱1W}0ؗަ zA߸}:.K.e⒕&*B1wyiр_ʕRuʐrx 9{l^^[h)Aus*l46hI^=iR뵬z/CWڑqԜ$ J=9Ω8=A]5-/-\.X Tjy8p?M;|HunYBcJ}2 :q62{뫮?o,inLH35NIYpG %(VRQE\c ~2BL ¥nJ UaDFKO6I ``%<>U4Z~MЃCCl 7Ń?Nu<;j?MkTm6#<+q?M\UPqI48T@Iu^NyBS5ni-xeut-yVrT &Q)jqPqԻrIHI֨^nx3)܏>Jb%RH(+NPVAƥ6ﮜ}uoS"e:y)mj -fuo )@nu ykJ߫@=+T0ye0)zsoiǽgΛ 1EzQoӧ;RHd`{-STSY.Dq䫏:Ikl_9(,oS>o9}L&-w*<w/'*F*Zq\Ԙ"4m/&-fUYBKHRI$+rH'PKDMԹ{57cWޞCѕx0Ah#t? u1PJ]ۍ"]@.^#hwy?u ഃP226#x$!#`JPNTqpju{bj.HFqxڅЈXju"`Q\vA%ԉ ݏ~' \#292TvҊIϱQ'[E+'$ST0p8 Ft@{MZ*S-~%L <3e:yvS>ѸZ yCwjOZPPΤʥUf9Q}TZd)J^Ԩ=$$yIX$i"Me^Uy,SٍL!D~rBn2JFHIύM[RDTCJ^BRVhiIQX>j;iT54o짌iaQ^JBQK8djtrK %_$D) F' 4l̝YbU? ŞˌzNՂmo{rm[~'tdV\I.%+xkpVs\\k;ۚٔ5RXCye)WIKQCi>t}iu{r|Z*#6!֝ =D;~Eig&Yn\yBFEMiRH!cA3l&,n/- o|;;.U %4q~AwWl£QjH8Ӫs|5u/kVòIwx#ښ{;ܧt_޲zmn wTPÅ(2n:n$Ec?6bMlPNNmO JIN|Wï]o/.ϸڔ)Zp\-!A=$?M]>K +pj$!ͭ$ q-MW 2"Ѕ{T ra%IhÁ A6XXpA!- >km0=. czm d cj:BIiiLx!,4^IH MiP*X%aD@|s%UJteB"HڀA!(r=g^2ngrĩĕ!9#?]brlg%@!BvŰ3Jn$'GM7H*v-.铓܎ EѕaƢǃ`!:n&>lZ[)/:j\RV$-ԭԯBJԍBPWFs晴ɇATXӕFJKwNNSpyXպuSLئwu ;˥,sq:/fT|A[QIPX'qq~U1_ep fNs6~U'z?P| Ze*UJC<-uxޢS8 Y8CVEԻMU6M0 '!8>VCf!*>D⧪ h7}4%U^h%vِK曩1rRerǾ ȉx\1ZKn J(K%͉>I'Ô(;Sw\-!) |~M_- HPZNsc5)Km[Skadl))Q};ptF϶4a/\{k({oe*NU#Q$^t҄qTb' 55h!-ӓ:H-meww0hY 2V 'Mْ Jp!M8c;}K]TJ9JZ67ӧ\ӤFdĦ:K ;^ YJ}}VNe7YBTNGAFKo7*4Iq;P\q*$gxTG2Ү2}-eXSSd|% q~v|\[\q)J^ܕ yw%,fKBwZ I'e#)u;Ҝ6(³+~vWn52$'iS:PkvPpBUdu;cZUIž9}ġ? wg 8,Z7&Z9u"E.cY$o3kSmteC%U__iǠLAIA[~N0}if={0nϜXmW;~`pyƾ'2u&Τ-m [;$vCEIƫX몌hsL)piE"b11(I~#2O ^]^RҔ7iqg3#F=&cjZIIe攒<>~ vݧٻc"@!K t|1I_1եO]}PEӄ{{M.%UWHIp\ϸ ްjѐ!N-կkhJRϤ$WiSۜ ąBJ`9>}Ov-ʥ@~R*ˋyŠdW$~ƴi8,RiB]a\nr3TLՒAM8ÊHW+ \1>:G|KIH󌁞up,6ݟp͕s?Vӝi&oHSԒc{Ɲw,kbdHvAKafPZ +I=9սma~lر!qLajIG筪e/6ŢBpG:^-aȷ(;jy7ׄt(b?hۼdIH'=9 Ω}0RcןJ$Q|YڒS$:}.)[jC]J\ 4HSgOhZIJJOry8j43E:n+.坬S5n4m vA |5UzP~{QjDIY!Ŭ ܕR *ҏXKnhW* F1LMnCIWݐsQNM\WR*VU.]NJ$>XK p9)(pg;y?8˘f!Żۊ0$>yֹ2S)$L$grrO8:k>{ٓ%ϗmIZKy)#>{iThTtВ)_XF>8X NpzHuQ**lMFSҗە4R[[d%9*8j^ܻ:b2*Ye]>_dy-H.ݔY %Lw/~x2Rq| ՛n\)4&D+ԢF 8Ջnk5OusmdžJ| c93/^Ϭ]=pnJKĴA! }m UjQuD=m7(  JHqtSM/msu9m M$dp3*%'1%Po"4y2Pˏ-8NsRCuuy8[G$N]5;K(iK.cHJ&]7J|‘ݛʜk>yӖ&y) V80Tǧ[^Z>\,]76^k>XӉqĊf0n$QHsp}f#vTj4QU22&H; {3rJiz07|V醜-(n2R%'mRs5z"ԫԠ1^1$ƂmJKҲڂ$\[2R$Go@X8p(u ( VGiȥva:WZ?N"*0\K:D0zboD6JR(g>ڢi:g< HM5OP"LhD% 3.А8sgS7Ml٥ITj"($qjL` зWp})OW+}aDK~ jB5r*r79d c9p^[DTUEard:u*,*%)FÅMHK M-RG (sR%092lg Op5ΩԨi"QW=.E#PZUpi(>zx88Uzxիx';+wNNr32Sd)ݻYY<x->b{BMƫċ9eq Ei Aʿ2t@~ 6Kk` aԨ_1OԠBgs=֑}5bńt\?Sn[75Pju*,hNeARH@+i_Ыrz㭻&+TuC%_p7cqPxU |κ\~ZYH$w ˧j79Ӈ܁?!OjI ^XIN!hIcdg5s'&;oD\%mR^pAG5}1ľwt/t3hw?uۊD6G}=ˎJ ξ*|xw[+Ve$J! 1Mu8Vy!juHc F _VR\&^m a+#P<lѥSlIw/!B/aJKFSHAH)NGruܷo؁h[Ԇ3OTq*l'9rdVG7RFjSLLkI8XNqF\CNCaM6 m*Q6}# J*425tϱ7.>PUX齃ITj]@Oka򁔊tmnd/ 'T-}"5RI [P!);sѸ;;rӭBLT\SIy (I%$9 (HNN BnҒ<I`չP~Y WZWF%k#B2Jα=5E."- ,6 H嵩'?1qtOm2߭.#M-f8SJq8Ȏ륤N6 )J>s09oK,6J;PR=IO8~IKHq^3i =qT?iU7Jvt5;Q;$(#xGπ~Qפl%Jy}Y,12bi఩kA58@#{' $!XPzɗYEJAjW)R_̃!)䌥g<|JJS-i-娡Ni83t1h0mi$TxϑcԨm]Os*ڔ(J`xH(FNn]atc8!I*Jpvwnj/}q 24@ܜ5 jR9Tƙ@}8UHt Np3iԯD^Q7XTŶʂ` 2}^1=GRR:.V3p}.WR%(`~|m$\&E*H<^մ;$qoViRMA3&8Q- a!Dd{GJ긑Ki#7Ԋ ʁ%RRBڊ a}O$%Y>z[JiVmsTm{HC1d2xjPvq6+leII)9#V8Jk)aіջ7'a >R}/|VߝSE&eMoyATJRpVx-*B*BS xQ$O7VzIușEJŶ { DjZ*C[e]T$wIOpg< ē}Ղ]9wk&tۣ=W\vӛS= -I)9^ Q<mNHy/vT*)A$3Ϫt_vW0KKma6Z֤4R$JAuF-ҽ*]ObGCަCk 8{rPQ5H%5F& 9UǨ gԿkr &@8k؎1Ll`ްS4X֟HOUI)Ki8v=R8fe=5rB(Jю9ƬV)nTei2z\8wҗUA!9^2~Uq|~Zzdụʸfu՟LYUww|2rHFqrI@KJ:rVIbPE=%ĥTX*W8<׾z>[ݩI.!)Ihm$9#V)j}YT*UI*CR򠤩n`om'=Gh%DxϥM!PT7c'/[k\HYFvŕ N0y2R.[XJq!cl뱤S$>qY';@H#3-**$D'd0m* vm>2VcNm,gC*u(wOŦ:[xk e۷Eب܆Wv’o(Dw;Rn' M\7Jk0pyMOU>4RrA U.KXA_z]aJ',6^ (3<<4+1Lvl̡AMe* #?O}6zd*Ib#64SN!#6vA$ƷܴjVCۊd6 8pdc>5Z][N蕛Nz\ScՍ)iێ%a+ʒ@>?vOXtVp^W :rԟen6RӮYb띹q rSm]u.Vq#f$9|gKӜڸjJ_7N)W)kmmqw#98'QbMjnG˔-睪 ':m~T+t;G-F!ζnG|!i’@!a$dLWFqu5uœH3TiUK:T 2FbhYmUt! _y-HiGx|JNnhC[ynZNA)$1q[ 1$Ґaim{Hj9?~4ޫЯsHmv i<+뭻_V7dJ $ȄKi$$$%C9m1Ce~lHsJZ@)+opBrp+5/Mo7kv| ;io8G%G *sH֕ Ƴqť\&;&3 N8Z-a@yqЩSMapikq(I'Տڇj8UTY>\xF?~~Dj s2=IRnj xTgԠJkz#`VAZ ?]m;ݍ} pȺj,hSҚf2Z ؜q9 VӸ $ZJSD/^S'␒I$H "⾩fъAJ )lҜik˞HO`@coFhe~sIaꝿ=kMjpU<6pzC%W4o6T9-xjIIMq3i)^VTOc鑫\i{l!B^w̺hJTŶ}k? Zܧ6=HQ|NUz:^gfe+  NI8Gĕ)4ztjHiCޠ[2 q(3Vm-MTd1ե%y)D|yu/WFY{[~[S-1;vd@aD,`?j\֘ Ld=){) L۫KaaH;H, SJ]Y-CRqXstH c8cBw];n; #* FO??]mhgKAqcuer"z8'rT<`}5_I0L(񤆔8c) Y۽***lImT'XX>:EflD6S_S^w6A8<'ӧ-B8+NFϩRO #ؐ|k絿vըFnMnÈPI) JG|'tT%:Imq"+RԂNN ʈ }@EnQU>*|S4& G%( 9/ +uI f,mK(%E)KfO} -4ˊB} 0pBhvǠN!1e H84ջe2X`[;%Y~cۏ}0/}D]*%Eue2܂Fr#Ry9մZZ^OS-kR|;˕HB$%ŧr’'#ӌZD;TˑJC͹ClKR *HJ' 3/)"*{̵6^[@N8 @q϶~zzm:Jbu`lDnj["ܦr[-8Ԝ-o( *%R ]SH%])\l'W rDg-6:ǒ2 ǹ_QaVK]. ȟgc>4 "GEzSnT-+uI;)ͨRTr1ޥ*jmKό9H:Bm?M?>MUjQ[u{[^ㄡ ~,ɸVG.-B/P@ڒ>vKoH">JhVC)T2N8΅ 5ռJG+Sy2L$@2}=z)Ű.kcMHqVHPCd:kGR3/XU.^txn8;|VeyœX'zSPW# zfq):_I݋*59ĭ*qkwP)'%C맥[E:jCKntgmQ% PpRqNcRm>r_}IQ8B)9#2* %4.r@S\$<ӺI2ۗT+fk{ӑi)$px5Ti/\>̵/3]ʒUKA[ƒ)yRgQٗoP\;@ٌZJw81qϝNEhL 6tpKQ7UaR[Z\w)Эuޱ4=ThR"djI~Ť'{{ܐ>t/WjɸRҊԶzA@XgƐ;-n0C2)5[ZnZ0`ƦwQRӆP(Z\} SjOw#U`X%i-J}LaA##>sרSoa{Ӿ7-:sNQd6^ŷ]^}kK`NNsY靇=O`f<ߤN%3rPݗ9KSˬAuhpBv%#AO4k}/)s&#P6$܍p'5 be͒^C3)!M#Ւ9(`d}WoX.flN ʁc'K7R~R>!5 tOJ-cAIt鲬ȳ]?TؗO' 飢uj,FdKJ=KR.# d":6@)p)@$ jAt=Q&dG%#t8K 327lZ=밥ގW=v;-T!waEװgQ?ZzV\\ư䅖7)]#HH$Pc:jؽ@s%;2.(C’2 |Zn'K%IJJyQDQ yԡT) SFxHVx4'ҩ2m7Ȋ7 G*NFAQJ*KT qk ;xpw=&U_n[; $pX$x 8ΖzUQRCKZԚ52j1T!Bq(lRqofijTHlMmqJF-G$Ew] ;m4NjL)fKgJ8shԙ0VS`DYZV RA${?OQV"l2ވeNlO0cTuU)}Ԕ/1] <3?ij\2ۍ2k'al W[G:#[Qͩ\=3κxVAR1@njjr΍["*^ ?!)F1kdg>̒3z2#n%jS{f$s2:mHSxb[~HÊB9R iNvdP%c[VDZl- jE- V%yI$ m JL[Ay5f>wpSA$]5TH[5y6ZJQ9QNs>J^3)eЄ#J1jP,kߗJ\y6r7%'(>yZ:;c[N˵j +[CRCʔ)$$qYX8Z6wQ|EwRoGMUmjԟmM1Bc:eX۳Β:;ZDBƦ̧Z+!#Lr:ֽ+,VOuTz3Ѿȣ%3^2C{OQ'~1nu|[&[X![a Z%@'>5$XHn`?Ay}O!m68a_ ~zк WEVHNH#8btTPy](F9\S ә O?9n x# Ox/ R੨Ki&qk/i{M7MT*Tų:yggTN~jͻȷ7X \ ('kʔ !IY57S^LUњV]r<*)퐽(JA9IԯuFW+ֽ> z2 -.'F ۂ}WٍJإ<&RA4 d;5t>D,tΧ%!A)H=:ZM~b Ni/Ă3Ұ=@}"TFp29eJՊuGTxV6uDc>%aI 疝Rw)xάyKL޵mˉ 3NBTĨa'@]8n/2fݤ\X\M:{ NJPC, :z}tkT&=*)qA#몝Ի( W!ح[ `9MOӗNߎCg,}!y*yպjR( `*qڳL.U֙LiҖ Ӑ#|e!WKa% 9>t#jweN99fJLRޜ 9"k˒Reǩ#Rd0089“5*ՋQ]wQ[&+LR}5WnS8֦ݱ‰QQnqƹzڛ܇%tww!PTx&ݍLe|ajܔФ9 ӟ2#RD-20%;N_:#uq4IL}I|y@܀39#ƶ'Tnm=iTدSU%ijSSk)`x~2eSiQ8 #HQJ)hԺ~T/>bK2)V|>|QYXmOCREB H#[ZP9ӲyV$Iǹ9Ӷ0)QV&U6mdX!K^ }i{K!Hʽi^2د%[%R)JCiZm7J-Q4}RZ]N-C֒R|1飯ҡpُRt"VhɐzRN@Biފ'Z3j[yuMsƸo -Z45 :Q,FQKje ,qx$c>NV{aI/Ɖ <ĞTx* }5PL,ƙS C>uQn΢^P(2d!>ˤzʂ'iそ;*۲D8)+wY*B'HxJ\?dd_:BaZxLӹOJ^RRd6Z@iWKj~Ũ˸%1Ir2aN䲞7w29g'NzXEA NUTX3 ҒPV1N'L;?(jz ;bBeC+I' $NN5g.ݬ{4eN֥{e99I--=$~}T1|}蒛JINRW#(cNsΜX*p)!$8B6)%Jc:e(2۩ljY-̷CMv &"e *|zr z<jiīԅ '?Om}zVb!q`NPy Khޝc )ImJ_KW9;ۚT]J 3V0N0xnuAT[wd6ZRӽy#[KN5-[(&R@KoK|5!+Qǐ>1' JukFYMG~va?{|,u%.#񯸽 ]?=Sr1JHVW!h<T[Ul[vpܦ$dÐ.mB2b2pϦ%?%/oX귄uJ) J>~uy\uJveV:-aj}}FmG׭EF}um7tTH#o>ޝ'Dc\Bh}J5N\QtB/+b*6yuz+Ms ^&ArIMqYպQS/Ee y8B(IrlEg GCEhBBp|irpT[Z(D!L#8c:ptEWm܂:+Hx:C+W`Z]=%$-)ڄH '>@Yed۔ՋM&JZzrRӝ@:y=5Emɴ) FZ׹RNP{;"=ӪwOe"kIR&JZۈ)Q+ߴ|jt|1$=>epT E)zg*RLeL-(doICu=e9&iQ$8ʕ5)F2r[XJX>x|@锪:% ~er%J.ꊐO#  `ND|DL]5M6Pm:Mf<Ami@(㕶$xϹ ŁqOE>bj4h:s}c(@>5 rK#jBuўI$ uY"ב4TH8b4p+zԂտqƂǾq4Nˣ3)*n0F>4<~7PjI¶<P''YMAjߐm5cIWe[=Ƥ3)O5mT֦cTAAXϥ^'44ߓ+6ICGB@ =R Eɨo%NIs7~'l# :O:h3u|+ W o\AnUi($M[6pa dg#9u"7ۉ zHLFĉwТ= >P`sf'!DqUl)?mⶠDuTOi{O:ʌxc cUhA x}|`umn͒-VOP^yCpmb*\6HR°A)I+xZkl}Tқb]HI| sjM>%"C= RrQq\m֭zMRnSReHt~ ÷_QP zILUkLtv6qR>W&/EeYvK5IRS{-n0C dkK*[>L.ܩ8NYVSU^BĤ8Q8R9?x SV¤ͩ>삽ݷm@mI 컚9NESReI9Bvg]9ܩ,/j*0n) ]gKJ 'm#h`@]Gʭ)Q=zK!)#2H#u7w-ul@M UXcHXʵWa9=p))6*-#0e7۫%>RA Rmkrb\a2*B$&[Bpyy\DaI*=Mq2`)-)OnW~ab*L=a.2ѷ$p1)_׺9ua׺Rmb >mX!%- nɫVbɞY~O.\w--86eh1;ao:ZvT֛u'9)^UHvK2Vy^qn $;F5ҴSŊpM,y;vs#I.v"2~^[VX2P/7&.d(vr1άlr7ERҥ; ;pq4ԬU(/*aIOs'89QcGҞAƽ-ʍJ:ڗ[RZɆ%\\@#>4yʐOQ^ Kuk1\Gd!.8۹H!9$j:{MƁԕZC TK@y]q6!c##ԵeY5u]D3%)\JBRJGF(NE>n_7: -ᬒv~I88I}7Xz%N[ [uIlڐs;qPp1Zʻ y큸%mȎ-IJSq]B&ڷ*v [$6>T6mD&2Ot:¢Itri(j蒸+jb!8ܝăq3jm@zI~b+52ہz<eFy'y8Xz-EQ`5JlDˉ*$CN-RN ӷc&2m5N^f^e-ښX~ :sn&I]fdHͼu*Ҭ\hqC.l"IOFѷq)) r8֕$O"U!ciǼ2ZiI۾3Hy®B>MrUPTX}LlV@'v7d'9ӤN GN]v]kn *&4%Jz9B’2@ԊNʄ]B-5) ĢKE)8H)>' *ieRߟU[U*;RiM}쥼$0OW=24d4nşBj;Ke[JJru~ٍlDQ^lQZ(KNR9>5Z? .[>5+ǝMVT{?۴r 'S;b֯K+TC+hRgr@鮻zA%R^LR@\YIC)FHG jV ]ȍn;NlΙ]ZȪUI6NM~SmU2~]^qU[*J:tY?mͦ@j5.kSm')8*޲'4}RՅpKQ(4mUQmȷtǖ/v\vsJ ?Rj'Ӧ1> jDg}BImBȃ^FmIQi P {˚Ѫhf ̶%Y,q;IRFI϶\SXvla j#BX(~xƜPޝC&C2k`Am FyYi]u٨LSl*%d ώ1tQr Ktvӓ+IHP1rPcZi}ҲBЬI>F1N'6UXY]U^SkT%=KB B rv8jU[1+K~9N?>}11f>S(-$AG.D=D;Qa h!@A aO,v^mHq*JkLiz><т<|jBz̹&3ϐTE A$g'ǎyΤWou:o͂R#SR8w$mZ@$ߗ\!'{(U VklxX2?_c2-N48Ts}6W]VU)BDhҟPڠR+mED W'kK?2S’p'_Q\a R8eg'RQݏquTjImN$ 'vRFF? /ވB9')#_wE3&_?3;+i16Ǚ{)n9z\ nU:mlñQRPC)P8s:\Ӑj$!xJi 0|Ze \Ŏwڕ*0\O(Tӡ )=ŗuQVUI5jc,oDGqeNw@#'#[φRzkeT1?! J.Di%%gR0r=rbcU'!Q`5()ۚ8`B9Ovṯfۆ}8>?M<\&; ):GGGtZ\f#!=eaqI)u'#|8ƚIH [hV3I>'/U$/^Q3&Um"*MeI\啬p PVêS_[P_ ͤ #gNJ25R}M)fr"eU.hn*15Tbx]Z}p֪h٘1iN[5 m SA[v%$G2%stމ-57 dD8p'\[ W-2/mS L8@F晴7Pظe4)1![8NJRTy 93Su_B)5dܕ(%UUjVwO\W'\0[1̄"CĘŦ79#zӃ'$]jrcu<ЪfD]9 *$ sN3TnӪlN]zRpPW.8[H Rk`8'ڣbPUnru0JRla`~,\"[U˄ $6sƶUnZEK%+uNBrͤN jmCui%+<ӶMO*iCR]BT7g + PJp5d̬ךZzU"e8`=9yF:%f9 ߥR E*ƃ|ZARU\"Ck݅p# i!< #ItK!uԢ}WD$HVҔ4$!YWsmu1Y vu2<92jQ Qm=q;QΦZTȰEMz*h4H;]Z+*Oƴļ6F&]rKD[úNqc:QJrˠǣIHPnB'y?>\42иM3Yچx _ƘFG.S2$*F2ByjJ2Ͷ Ukrƥ\$z6VSܕ)$J#9nGBKN[mN}Cyʔ2y e^T+% $$ ZҐ{cOŁ:ڙZIZqjLPOl㲵NU:$uPcU&{o{bJA5D]R~וIa!؎y~y8vިCCJ#FT U(O:OSQC@LZDiM8QޟFN1e%d~e՜ :eovg"|1VU* $mŽޖP:S3Hf[O=*QS.J[u 8ݝ>:7sͧNvUbdkP NlŽ+uMb)\[%)%M @ t+;(pĒy R$i\ L5%̦TR0x#U=5 STL/Kex'dp?Yʧg{ k[kh*!*FNHƧTd'['VÅkaI{u(1^ hud#+jTG>OjC$.6CpSNԶ $s/IvQ'\q*ȮZ8]2Y ` *R01"S/ܰ_NB{Ԗ\mؒw$|8Wõgų9(myX+ZvW2tt})M~RVc8ʉ9qF SZ-N&HZB伢ǡC}9ιųpS\F+N JJCN8'Rm⹖=~5-ApܑN &DˁhK`8dtdVU].*[Q*2jfݚġ)YTRp6_v[wE4%Q̒R$#uڞbݱd÷cu1ǛpřǯxFR %$<]< 4I}RI ZsύuUuz_qMbrR^KQ!?*Jֶһcjpd+$XcZli H99g5tbϏWmͦ#hT|Kkqڐ(y`bLTFle;~hQYY 9:G)#v5(;QOe*mq9f=h^E*;U8uJaL$IW '#Sm256 "JrX5lԐBGu>82JwVgãj5bWV簖>u];b2)giO={4\kMfSpCC΀yJ22Nsc.tܖڍNU"d@-r&r q*\' pt6rv-,ɦQ٘gBUI!YQw)I*p.*UVy+HSisĔ2x+2%? .*tyBQ IdlR}϶>2)n6Q! ](r~Pn, LunBRS-Y+GE5[J$돯܏S}ꑴ Y߅ `}$Xc&ܢQ][15I# 8FNÀD鍵)IdSߞzFBDU;gBF<)uЩ^utS܇Rv!Ć %+'yΟvӮ W%3TˇbS 0}駴ΙejGS`rTv~DxQk=F"d&B3֗h0[)N@~y=.Kv@Prqiz iq G9TJ÷V!@U^3NORb>'C,bH Q(5R,9t;*CҚqPT<~,Tqjοb~\Qy^悗O7Na+)VJA) Qgz&aBk L4\BHIm%${d:hi˜zqC{: /3qL*h Ihn@*Ōl{gYKQ*9t>`j][S2)mh {uFZ9`E,77H TJ JBJD$Q<6 OUv_q.Lp)-P=d|N\Gjnvݽ)J\5^FւCU.Zܳ*=bT q('(T}>\ QLT@wJޥ g$j2se&a3Mj>*e}M@ϏSLʵ2tٌQK'eWCHvO%ǒQ'RRWOqVUJe϶`mJ}:{7z}Pz*lKJ$@$='>U:-q\$H̩<{4$c;J'?Cu,lKba#+uD[lAp ƓQJߌ}YcCBdR@ӑ6~k&9RfK쬌}Fv=LN$!*G?-e}~Lk,>TEeY,\a|@J}M6Imx##Q]auXbK)%( a]9JAԦFlLGΓSMFۃa7+SDߏ GSͽ@,)B)Jv J$8:@n§Ip0ݖ[I[J$*x#:Em]E<-NQlMӎȚ.;mn}uVp4Y.A NJRF}ȝ3f-^e?AW}彀UzITgΣDjPrϖjZ4 < nWa ڌYK~FN RV8,LRCm%|8Gؤ?Lm!*W?'i~5X٫ر"Z51U8˵_jFSť)'?mLPfs~Q\.K@A<g[q!Wnr݇GC~JkirpK7< 6%SKvT qΩ\:UR~U-nO}|:=H>Pr>:½m W>$v#EN-ssВQFzB~ɣs+m'2ۦ4QS! $~N^Z\FҟuGS]/ู䏋ʎ䊽:Kqx[ 䄑>4{ 'N"dĀJN=HYyԝoU+T|5 88#PoDkk0R\9uJaKx8ciQFG8#:GIKPH;<vkpxE˦Ow\OxxJI&vv؜~>}I1MjP+ Zw̥A^puYwPE~hX'R+ K-]Fv' |itsS魺V" ΑYfi=ī nݔ8@`yLƷLV椙n%jJZ{O28ϝ*r.JK%&;R<:R.9ɡ'KPL,,s)$wV+څe}< /Y>Kv)8JD݇YB}'+;sjF(P;bVe58/a>VRIVv9JPYST,W=I”h6YZy $,5qmV_hm.vĊDvq}81ҮGlxVT*Zciao8Rn$3F?*Dm6G` 獫ݜ`5Yu)>A܈` :ҶO;'v0(X'ǓCYaՏ_ /VkEzji0TʫS&ca[UMT_z=|vzv7G9$k.)U4UZG1LYH S>rp8#ݕ 2SO6|T!d6NTVฑ 4ƚ!8 8)P rNO-*&L R9Pi*JppA''Ϋ"[i5#-2\Y8 =#E}2*c6w_l G놋֍U=W9.+#zkI5ݲP)aZr VB+R{X.ܶhSemB F7ožH{'$p|ek W FAqb\I=Qt"|;9>:pVzuD(sRZW8Fw :w!?jK)A.GI yVx%' nӟ}iL)_i %)W?M<`I %zʣM}+``p7{RZ"[5×cY=~G>z]seInB8;<->F5IkWL_VRJp X>s=62ZUc,.,-c(IPsơJoK1[-hZ4K'j fO> Nl*~]Idt(;`1Q*-)!A(ӆOzEx3ObekQBҗN.H.MJԃ Jq(7(y9Ɣ |lʫ:!I!"2g;$ߟj>"3 &@j3#+x)8 ~Ҳ14ئ۔~Oe)%MmByΉPQnrq3":#c|R;vV%[$&UL=ZTHBq;W';A?",V*rIj2aϤ){+*HNQuꄥNKr#NwUwFra"O\R 6($qΦNXNaq.:Sy8N')B*(SYO=˲UJib5y9^VgstJD9J )n)3/66Zp2Z[b5ٸCnN*->oBTpǟmEz҆UvRw;ם/.F#hyPG>yը:i*r^Ї\R >u1WrHa>\'CwbS|iݗ Cϫr3%b$Jz-WB`.17sz4jX`WT֐DFHRH)8$Erm8=U!;E@:rP x85j>0:7~Uj"*KH|8z~T689ΣBMLjM_ dTݴ[J8X7r2Gd!*HP9dzRyPgu >2gi1m O ǶlحLbK̟JR%Y'D*Բ:,y jXhSENv *w?M4o7G*!RԍyAYtrVPuJ4, H1 c$'ϑl4NKjYuZ}xP!M4n3IQ1?t(5vʞdzUT*-L 1%֛*8 #ƯI>czTU}N ] %i'a)A>⟹֋)e1# ֊YkǨƱ*-!f\jcKq9iƒenF# f9k?#kK%P”RGimS߬:ak`Nr6c:SԘ֖]0)NqF?~dF-Pc̩i 1JyO!XZ:5[6/t^C%cuZUˑME64QR1k'bI5,u.So_֔( ˘3-n}RQ!)NG+UF[ Frlc.kJB\Z+vyE}YȦjt8ڝ"ׯJ} 7 bH)XwZ*N6 @lI!:۾*RYB0UEm!Ӂ!AIݜ8ӷBBcBaaǹ-(`5F_[y*[sd Np =6)X~u{-uâW >zCdE;Rڊ64MۓmU >TI^nOT.2֤)o AW< jv}>Jݐ&T+W|4;b$2$>Onkuɥ:R([!ǽ!@$6'0 2x7O/DbNBVHaN1=qn ;Bj q:-Rpgqjى&.e8c:U'A9 y9}PH ԟs.l**CyNF}ƖTlD.&/ÇEjECN04|6VV2Vrr #:XiTR"ηENC41ԘېC'9J#8۟q}ZVrD^]:*}nL7VS9yBXcipفY(>= uUF AqKqr`%Dn/jmUDmx*Xe dRUz߱)S_raDԴShHQå IqndMѮnS unL 65&nji ݼ:xQYìnQ0A|R*kZ)&*_`o' +>J}Zl%YOiߚajmhԫ;wFӶ .jMZ<:h&V֘КqP%س;@I~ʗI^f1QL)p*(wch֬ONϒ.ԅi%/@ {5T0Bę)#|[4JSϨ$ic4ZOJ5})!S( d}VR(g{jt-Ӗz jE}R,L[&Zm-`;8P<+~Q:#(pbew}.!VJJs2[s=:kH`p#jPNBBG0F5Y}*&۔z%>ڮPFD)Dc/) RgvTI:ꔈJ(Ǔ7j56+ w0̄ (N9p>>4R:Br!jNTRKNy0N)kZKa%J*I8$siMLvҔTޒG.b@ `<{dҫN6p|노iTv]qTTǹ{륕H-^2LKnC? (55#3~+pN$,ݪ)uРSεpXʻkF<SyHF[G1dD{d[Z8 M"|!M%+ )*ޓ5@** O8o5Wz ZQF|d__"B%G CdZ# IB~ZhѪ~ѣF4hѣF4hѣF4hѣF4hѣFFu#@hJ*9>u44hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4k&G!cQt_ Y{\OLsNSS5S5^@)׉)ѣF4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4i۩;]paNͺ#(YXMe\M_VעQ?gTZO>75'LZ/x_9[#:~1 ]쀽};D)H5ƫfmV:!O4)A@)qH׍ʕ$z^P?-0ڷj\QM4-U )G^?3$lĴ2R=9l5*%Ag8' a|cONZeէ<ŕskuvy݌瓨_t^E^6Tq*q+0[|PROV:Ӿj>]ry ai A)J8*Y½Z:- HYP)ͼHBP휩~[$9'fzsSqn&}hFSOD2pvySGMqJ Xt608ImfE1iЦ M|r>\Ln'޿?ЯKҚ%[h+&͵c\6F;<)J[m%!(IPڟ''r_T-IufdEmPHTR6'yR0@WQ.ޑMSRLʡ)  *# i?AbP[}aɺQES.)U/rOHHuCU:_ǡy%G(s ir=yRhꥡIQqHgR%ҪYDVZa/*Q EM$4sm.)M6!G@?LY_uUHC- vP^Qs; JӁ# ZU[Z z&9uv Np~uuQK]EfRm Gq<}4RDZ>T2tm!QP<( 8UQlr_rHJC%Q弣!WS {{NY^YdE&׉4GM"\6y@nt+ 6?e UZ}M 9nӿ&uS"L^C羊~Z595 ql`2*@K<Oj[9->nujNTp$ʧF;=qgSȌk U i31, JRۏ:ߺr6xAK3Ϟa+YNP)**>݀@Ӄ]d%o6){Q̉%rmNS['(Q8kvu[)a0aGjQOJdUoCKVRO`siUpI.SUA^aM$ c j5TUI_4^KRĕ7JKiP mAZ~ѤmeH hAw$-NrJ[)-4L, QVv".mTLߴ+;ҶIQޣPƬz]&yjh)NU\jAs#$`p4>%5?gQӚ +zLgRHBO'T޸ڣS"+/^JQh>l*JLuwmLvW>Hi%A{@fwR&-\@$O>4ӢTe*nJ\ TڤWLP9Q ܯaWe9LY%ĶZKyFmn#>uJz%%_sH]Q$;2K%l<ƙWN]q`H}u6dFuĥ rFТFsST2Pya[AN>l?.u)rRpmqN@'rՑӼ8EnSWRh4硴NJm#rRIR#  M_VZ\pi*ifck Jh$zI4:(ׯ{ۋwSO$o#Rx 'Itv"UN*M1 XTZRBF:dU7>mqqe \8I>s3}JlMj$򒖟\D~'iU%HjضIڀ^}DUAjf!UjرdԘK<%%0UƮiIYF :Tj+OrUUޫèȗ}-kbV jd甔\Ӏ2H骥EvD_G>"VtzI3*i_hd x,oG%sip|MuEhu9ϒr0'aA@^_UZbջIMa«5!/GmzN2R9j.dtHi\@(+%-Jc:͘xr,gW!FBJ\q f3>-jaK%Ì;c }8޶7%"mJA[%\H8ϟ:^BB1VGnRH<}x1%֚z+.B'ZTM=Sfќn:.pɎnHKHy##O MjE87"CрH8Wv_9u%m=.t369ʖ(r'R Zo)ap%QR #dzFry8Q-VQoRZڂ!C)صq:IH0>Z].k/ɥ\!Ÿ<-#F6{Y, 6ҿE-x6$w):|۳.gsuhm78xoRRAIV6 Z|4IKe@iw< D[ m4gyqc!$nҹHW͠/Pndν*H)/Ay+wMx%[RBR}%AJϱ#9jo]Q%pT(2~XX8$ε]!R}AV#3Sz &P"Sk Tff"Lhbj6BJHÊޑ8S3R4k 4)+6Yt DVu7}Wa'29[+F ALӬ(@N6' 7g_T'%ZWb n('v'R|"z^ETSMr<_JuKZ+SDYjDͫp-1Og}OΖןPݲ[W4FT]-\vʖ%%/Cͥ6T VZƛC%DM&!_BN0~uu/3\nۦ/_oӎ$ז8T8\)]zc%ٷ*$86!䵐V2s_Gєߩ/o\u_e ^©u,Vv%ؤs*9xjKW\贺ӷU=I])'В#cύE _ 2j=IcNRimqmY.!cÑ}jEkSLzMW  ^"VR 8O>ӸtDO-E֭{8}?ۦu]*ʉۏŁ9Mb;i*M |4:D@OУ$kΟ_jRYTRBtTviB[|u_dH~+~4fZ%b K6( J`F:l_3d]vK|h!)+ F )Τu ,.WY^Vq”*g:V}kv rJCmNڔ̘N#ҁ_ ,t+|'$)LRYPxAΉZ vmT-ɪT(!zPI$d!UG*.Um5Ua(z1) Ɛj]$jۏ"-4)V8:j>)O=Q .+l:Cr #$ xgέG7W@=٨eBN+I;>5SS,m؏m$nzD]k@ mӝ %jRSNyΟvV@ W)2dG\vёŸZGˠD`ȶViQQ?+]=P9@KB[Wر wVAӊ)wb 8ܦ=gF|4l5A#Ԋð}G(qrtSԨȧҟQ=e*n7iv;쓑3ib`uƸK3kyPT|EJHO)*%'D%ZTiGd8V7$~eWᙌ +׾#`O9tݷsQ-gۯHd,n+ηRKm!u}L-gsmcMG8NTClu/s Ӣ8< $ w9cu$)-aQpʇ?9R|sΘ+Э|пӏ5+b;-/ JRwq:/5JЃĠԙd$g}3&ħ_i0c~T3W D3&͐HjoK͔ŸNJd P#2m;IdvJLYR[G `z@:Qo6Lsk.*ɖ{ń5Ϝ8nKŇ9 J:,mΌ(i8ʕl;q:P)yYkӚZJNoRv LD tگvm\%=p Jp dqM5 U6UE*$vVyΖjbM6jN8PWI\u>@dU*f6l>\4?{:р\x4{ wT"drxIqe֕Fݓ/?ך+ˠT %?>%{)A)'MMoPoImi/>[NpjF=PGojZ~[[ R&Fvl܂r03-۶}vb!IMfǭ qֵ>URҜ85-w}j*D5!J<ߒNx wDkJj)ʊZ(mSrݰ2$BJRGcQ;J..iQkL$6}δ6.}ԫNi")3/+tS .Im'$w@H. vt[.i)VR JO=Hl~AŪ?OhjM*84 P p8QWs+ά K-EqTlʄ[BB3i$-m %#F|wHMLN]bk&IN ΛX_VXh4HSG<}3c%96n$ugHcEzOTUiGq0;0I y7' iv ^<:]qb}8hPCq)RAdqRl~PWKTZZJAr[I(* uVaGo֝aZtEI @9k[25HҮYn"}J&g9<-iԺ]#71xO< qνǥv6ťJՏix/S,2yL| () {xKVCI>pZx%ZZz\ wB| 2$$,o[JznӖvzU%jSOTƇ *$Y6T}D#98>ߞnը57"Ⴠ)_N9ƻ+N\S-Y| uV*;}s26sЛ>[5HTϴ\S\I#2[P !gGgTv]vTZSʎmT@R_A^'SJnE2њ *w)-TR::C *DqDCKI!iK!yy8.J:~].hnH-JB86`m'}??u]7\R0GIϨ8ƬmԪWPC֛m|88烤ă&f\oe'8 {U]g |TèZˌO? ԒTNws>3qgӾ]^ujzヺ+=JVЕs8~|2ݿeH˧Ѧ0@ǔ `N9 B|H t3RU.k8$+iQJJ2<ťIP ƹԩO2h3$֥ 94#-;i[EAPVEu%R$+ƨuWW bSg-ifx![6 S%CLfZvT8ܴzTHOqd*N-TD۲%}*Qu1)?3|jAjhT&rXܶY[d 0y p7]qnEҫCqޙLiASPp8JG9W;ZE_cBS'9)HeM+) 6OmIpN5_QUԈM@BS8SzW[6\&]r FRa$,aJ(L2buwҬ`4Rq#M=TԘKr~Y+2+Ojy+C-c[AȺ'īT*MB^ZmSek .o6mFmZ-Vޕ/XKm,T68#ʆGƤӢV]jWSeIC=OkҸV ®/t&_(vKna-Iq\e$FrƠj.D1cI-2PXe^s+ mI;qxζR\J5M-ESw# N dy"Rɍb*P\ie?$r3IƢm:%iXS:_/4C|8xՑZܳ\1hJ'BݩL[.ֻd$J _j2] ʳ1M/v6qIVWFjeU)t^EnT蔥͉>EZ)u"C;e_RI&,m!.)+iI>nիĩވ_5BVJBG 'i |ߩ۲AzMMZmHNT8HڲAEz3f]Az6u!cDJ1lFS0qޢT.JE*Vu6R'Gu䄬p 2?~n3Ȝ@.`%}m' E.-")ckmQ2@gΉ5)K\G[rGGsj4KaJrHϾO]dJx}oGWF/M z_`~cl+ᷤѤ6ֵ1}N!|6Lޒ$*ҤckIz5/CK.6y3ҫO-Lq(P17k]%)KuNˁ);[Vq?NQv7)60 [![;Iϟi+rְcw(J9iAH)*R:ݹ^ܥ98:ױ xG~)#pisA:nL\-$6(Z ͡.E ##\źLW).$7qnr9`G~[rTxRx#B0[i/# ѻЕ w|kеvwWQ&[֏2FG9N݇3u'Ѫ]H)ȕڅ&Yy[p_,ExiD'8O^nN|T@?2<깫+RNdqxt²JmFɯӬCr%uI'j3S|gS.?EEkLJߩCM tm!83Ǎ}<1evV;hѣUF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hFɯX&G!$WG^5S}?uӮj&9TįzįxCא" Au AthѣAF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4g4hѣF4hѣF4hѣF4hѣF4hѣF]paNͺz۩;i~>k⅟5ɫZikz'-N-Dأ]ů?-zP%QJ1jpM4[tW:f~]XMG*3G.4ZXu`)R@c Lz4Pyy+Bg?]ZuFXkKvS㐝 la~\Yw^$רSj!\8J@xRq,! %@qjݿ:bXʴ,'tҐRo|y%iG0CW:7)**'Hx}ipckBmT-$wnh ƚEIZiZgZ}َ>ÉBAYn` M{L΂)8Qlݓvʹx6>$.k#y$cks}\ 寇%i'[_l"NZiaZWoCHSěS!n!G=1"%[9W$v_j4@Hd/*I.+4 !k^vprsGAzu^KUUoSb:Qm!069H9DoDb.Hw-*tS#n\8VPێ8A9@JƢZ \PG )daJJrN0urQZo1V]nm~?KP*3Qoy[IBսN9 VH-'\);ۖoFBŮmjp!arP(*ʓʰ4/+:uAoJٝbOKfr$ڐ֑6SFA?Sݴ-$캽iHmUfq8Mm¬a m% cRwJ\ o{ieFU&ZRĐ6Φ͡U*ȸ b[*c$4xA> $ :M)uhÉ)/j}ys\FYշ/rTCaWm>gFf+qcj^dÌc@@ܹٔAQI{iIC F0Gҽ:\} 2Ljg{.$dcIuR&P{㊏O8 j*β֓A[HM[L2>ĎtuFn|wFOӺXmjzt9 R!_>ڊl71Ɗj\E([Ҝ'*Ǎ@zS6vB]V-ۀnX J5en#5%ECpq] I#}>rUO2iIjCכ*䤕\t׹h-r|RS!~L#9<$]D\pdM)w2ueXm%?D K00|_Qi=Ad\$\֣R?e`!KʼrއmޖmUVAmazh P L;#)(^}ZBu"UL:EN w - ZF -:tΦJE&Ӯl&Q^8Ɨg\vE=;8ǀJЦ >]NuRMȵj4Y;.%JQARE +̫[YqdHB~ϭɰJK/۪dJ9@eZ=NR S1Ȯ6';ANz'Kzі":ܩQ&B"6$#+;%%㑏 $J^ܾ(0*c.$RB۔~^Hyձ *6-\g#s^5D[ʨ_aܕy<ÀR%$Vwd:l8[7rcB@% Rsß~t~ѥA@[nޕH >]PSK(lOE.5FܪE!grRF/ HWƬ5GEj} } ڝF;Mޥ5 peYR+@ :Xf[;)1^ye%IBI=BxFuR竻}(:Yq-)$mY$ F5ubۋ.M1Tch:q?MKZW]Fc!\{ԒNQ }SOW> o.nzܨv-Aq%(KVRżrT1ƬWß “"%"d"dݡC P8NVi–p]]OcS7U]bmp$+OQ/G[#|; 4&Z)R NOUC?ѯރZU^ČDm3 q8{|_|o?`3R1nЩ.DCqNr;Xܠ hczwfG.{c8 ~iՈn7JmSjLsRmrN1Hu6^zc%E A*qߏm5(gdܨ4$:_<3k 8*e`gbuw⪙h)J;MAS2)BJ!J))'CHsnmQ-il|OrD)Amp 􁷝RV@ riUnBRPEGnHO'Ǹu'^BEFt1oʀq} 8Uz?ۑ-,︱I _ґ].ɔ%R"yLqBGF$N;RBQp| x*/Ehvޖ%MƞuJd< ՟}.먗=`]*O5V}da|e3œ5ZE*Ѭ0er2>./ !֪2mnר>-!IU%O sSCv:WI xĂƟVȔJ呖R^<ϒH5c'kœ~)N(SQju0a@`w.y7u(YWMbB\Pd"-<:3JH(;AYTr\U*gbm 3 !Cs-+JpT|s$A5s5L՚$$U)G<([6Bt5R܊:D* 'gx:[aj]*# ]iAKW>y=bS/JNE\u2Dq(nxrFN:/C,ޣt/.QcLsβ8OfۙX@(MrjqeB}\jU:lZ4qڨR:eS)TWl)+eyIFLzv,(ʂۇO%A;s+KEBԻF QI~vʒp}HqΘo\OPBBԕ’ r6$}5n*ml;6H(!vwI)8 09ӧ4تt8fY+*}ؖĪdRV9gi[ۚʁ(+tgvŽ.St>˂kn'rGiw7'σ7nǪcoZ6bF=JVHV Λͽ>E]v LMWzH;TGt qr9JKWN={o͢#*_ECgUI(ldC|:ٽ16zz% M((1S'r~'ՍAHJ9Q DU8y8X;}# 9՝:7l:EU|U]ÉLk)Hv@ZQV/U\it5oȄԩM8ǥjKAnQ UgM~̩ԺɟʒKBոR~xwT)' ~Ą(9U:Grf$!JnL(Ku׷>E/n ;!a*%9#w(czm۲:qkws$[RU%ߕr4ZZiK}ԉ5!܌ǔ9S~y$#Muzt֨1mRP}2$sJ{dz#ݮ[!.JI NqA 9=PA $ѠDߗQ@BBʓ#Ɨ"R-RN6@0=#Ǔ)[RZ5 /<u2wA4Z?1~7 ʏ}Lj[I7 kjI^ jEʄtd%m\;σ9 *TūT魱XdƔcr!Gzgr@e!r/ v"07t`ayI !'q.5QLcpX }\Z 8pF|iӱ g-PEam[c!!-G8Ry5[xÚ>ۅge]ī9Jq\=5MSOb £72BEG6yH࢜XY=Nbe^ئK-~C5TYmJQK BvxI X'ܔF^6[2i v;.Ei30YR9TFq[`Aq\c&b҄ꅿk_.`~,u_#:ia4,s딃AjBNwH BJNKmw Ss%t,G(}t\wMV!LEQRU9fO"| BZ}[''xP qǍNT'J퐤 @½5ϫS]i1"nO(U5b)JY[ +q G'ryO`їkW5:^*t ; \Ka> >IΥJG:kΠ\V]Diñ-H,$`d~#dj^jrWʺ5A=9Κv:!fU%'9j6gD\.؆yk(q$X\gS8w6H*5<\-K+vwD[ U;!Ъ<-%;H1x՗g=:T("$[H qxo #c )J䌜x<3n%veVT:)Ĵۘ2IP>O9Lgƽ?g6کC%RVIIVB3N UQZhƎR88*>>{)Jgw uŧ4=m!I p <+{Z}hj_\i6b׻YT> 4u&!A.62F9kU})nWߚCe!'.%I}R 8Pt/^K(L:*(zj™Ap6jr߲<̗CM 6=VߣFHԩ (1+,IӦ?58SmQ}@'iVq}x*?N"/ʨljX1e8 xԍ*>ĦKJ0OiJJO<}ymبTؔF>q$Φ$+/p!lAЭ#Je&R*rഥ2 ܇8%E'vH:~޿32.ܝV:LnRÝP)jܒV/S%ږrdrmAP' ;|h=/ttԣUif{)r\iN%E<'UPѺVQ\S˘ky)O9Oqd^B4gYƚYJBT>Prsqƾ#Gp\ 2 $ ct;:]&ߔKisi$Jƈq.֢X :"kXBr$8T,BucyZ=X騨 [{]!cj$ \]*\)b󑼂Wۅ c9Ο_b, .>e=0%-#cMd 888sXM1.nEa f9Ry.($S ]@w@+ʦ"K1i ' dkBeR'2:ܺh?^qxOa+ړ BBFX`Hl΂Yqh(㦢a)J Ki=xV;cѩ4[="Y Tˌ!\N8P23mPY^rDGS^Oܗg!e+nyˆΜ]5l5vezBˌa{d'lP9;8gm"yI -'j¹r+6e^%N >Y qE @ǝ3) "@maVǂw ? Xn95B:"TDj,!gOaiW#WZ T1ZVBA9+JAxӢ5:즪D*UBH`ّ)$(*BPV3*LHCXqjJR91H,̯j[I 'g/,0RyBgOooTMVzMTyE>DbxR۪c{玪5>PuI,# Jq>BlVUP.')<}52]]`إ'E%9FyϐtݼOa*Im̈%{;Tya (}& +aB$>Κ)ʯžt#2K.">^CJ#bppsye":mW&ٙrAaNiB{vHƝ4n%5Yם[oBESK) >ζW}HRAxuHScn߻o8'5"˙WZmtA;NSNUm]U0[Y3$Ax4i[_O:7}ii."TD류WZ쵼f7&Cn0Ucm0-FR>Ha3|3ƑĈ3#*"Y%e*ZRKh)Vøc<}Ft($FV=Gasu^T%HFRr sR4\k),CK(2]>Ss6!ڬ([yRXK;Gory!'Ε&"hW ĤJHR9{XT{vٍNb~RK8`ch݁E ˆF.)L {'aA[Gujm-NIs0rzBjv$U.R$Jշ%jM{KTz8T8mDYx9]w \Tz~\}֮(ȒK삒:ߜ>r=jI9#SYu25‘؟ġDrII2dVҢHYmiDCIp:Bs@Ͼ3]Փv.HQg-NLjaO'jOd񪤜VߑH{jPaJmV-)B8P^x8<}`:q:t!BmS/ژctt ]Pj:ݭZWk kRq@{J}aeٯi=&oinV$zy9i↥IqК! N15~S\FTV8Iǝ'(4땙,Os2OݪQ4QW-ɳJIfe^)*$!) @@ /j8\$?Fݑ|'wh(Hx,]MtފWޘˑy Յd/>9/\5"ϭ,k.6L}A!$Wj:Î$bI/_b @SN[Fd2AJyۿ~q7Aͩq+`_7ܿ`Mpӥ߁膤QVध?WLL+)N$:KĽPĒmdiքmjZU.(#U3\+ՋjFY%$%WgI<14HQI5)U:v y %daa:{.KY{rC\ݐ6ܑϞBo6!BR nYzxGrRp %%/AKoc98Ʈ{"_oOr^(mm jtz!!&ʔ9V:tkL#ncM*B(8T\̀vuG=N*%enBL;з%*;4HVu4mZZib߂?"(+q|iQH~!E¢@zF qA*s3WD@]E *i*\B[FAơ ڄh7n Y$ԛҫJ ZW`&u)%*N#G'gZTUľH_ʸѣ[Tv$[UWF̃rqtHujhmb54`Nw$~D\!ӛ̩͗=.! ^͸8w}X`j|Tu>NZˬSXokmԔbX,\IQ9±BzLgdGiyY*v( Mv 5h}TnUb1E%2JIA#n'8>qhoZ͏sWW50Vʸ[ F’3UcTg?k:/* QM-B-Ǥ(ʓxRoS+.puzʋ%5&*nm[eVRT}=n[eZz*nȏ:D u)KwRogunPӥLDb =[%'7) I: %Ib*sȦ2 |'ƣѪ8HqPrJ)#9 ʹmvWhQ]ե1ԅzU$E~-9VlŸ"} K+q*Mu((PAi4Y%9nxR]^- k, T⟴ݔ_.!Oۜ6m h:\3))L٣I1 @eJRT9;v}6.לGQZZ6=9?-LCkw-Q>4./;(RO9#Nڥ̧S)3JJyr<0ā^ ]%&RkʸD46RwRa \ zNęBzSmRpa)hCh$V@ gG^l75]TU5%N8uȮ\m [FTJR0sL H>TWSl;!1O+9 LzESȀï"T3H8ہ !( )%նA}y϶jJ3͍U<]#ˏ-AD(! GiXkqkbM\JP r3L&.wKn)#r?-tm|6~WRݍS12P̘ Z l# G Μ42[QmƞG*`g>tƏYl v`eC%j@9ju>k&AJʷ)KN1CI-*mT#? J9I7Eɐ؇6)H}L8򬌕0@N"- \dlÏ4_Si/S !E nAw |EW<-/ⓂJH'AHWh,$>M1/k֕`AiI|>4ؓUZT*sjRV\*y>H<tS{ kS6cM su% 659<& /;5=!JHBJZMLY;u[l/c l ʚuI(*Oj$BxZ4h%F4hѣF4hѯxǾ}4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFd?ìu_#~/`kɟ:5S}?tWWuWWu!??׺??׺4hѠѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF2Cu/Gt+)?RwV| ?U?k?W鬵ɫӊZO>75'LZpZ^'F_Sy[#ցk||_Σ̀DZ^zBA>R2Af%Xj5)rv#S2TQguGr$ydȧ*˄/1]>zQdt1!!о.kd |kܤ#g+nWSB$]Jcoy)ެ%I996/u6meVK-:Lf@a Ji@°(gcRE T`Ӯ-Qız90sv,;}n:rq#D:qd2R•tm5n9 } lvJNR9?\u95'\N-EmQOe s8J5,ʭ*oO-OnDzvq R^[ +/+04RFOd0cR{3J["!pUz3bF@bLHf,x ps?hu8TW-ȰSmUYzgq).emy'kVB݆S|\2bTҥJ!Bl*JP @H*Τz۩P5VkO\תHŻ,'[ VGS3P|(F9Vx=mR^y+ԠC$%~q:tWơ3\*m %+ A#>そsLASf] S\*e+IS5\B~ɵ_ ^򼛕BpnCFCR焞Oc:aC࢖:;]\fcX{q p_00FԆwtrj!5%[N!i)BxC* 3-:'ү8)MYC:*m Kc"Tkꏄ- {'' B]Vr7 9JSv?yya־JsmgR iqpJN `U2Z(4Pܱ4-t{cSU>͡]i[hXBI9x'R)jMtUMFKї!X$>6Y<pd(F LJj5W% ii,+iPBӌ][4(ͱG7Je eTaN[YZ{l,ۀx:nH0c[B_!J DgMVؤW K-ɕFRQ%/sJqyK].:SMb :{AVyRWFsҧWnm3oJ]bGA'FG`{ ݖZ7N KW(uJD]NY)f˘e;AorjQ.QU*o`F܀6I%$=:v=/u3Qk4Sr|uRzJڜ̿S&uFgQRP I֋[T9)t(_S PN6RH'u$Uh4ۖPjaj>U+Nr@|dƘ Ҧ&ǣ?o6 cv !g?]Uƴtv}n RTѩkU6]R!nKDRqzBtZhԖ:7' 5վͭZ:2ˎWq6JՑ9 @pH:  E5[ڝ7)ĖLaV%m  ?Tl}6hXwvӀI<Ε߀hJ[?v3ȯMDB7&% +'Qq*yn*C&v^TN289:3v^7EJֱ\[2ĉ(WS&mN$)iJPvQqR=Z\qTP{4[iM,@AϾ--lUy4'PVv~y╞YDžGwum9$%nRB#i*㓀#zRgTSC 9%iIjQQTt/ґ(&R !PÝv uBur vPzԦEX ) O?Zlm$ }q?SfZ\!^[PIϧ4*նOp@Ny54:;jn@o"A󥁻/i&+R(u챝ze6iBR7k }OYGqVPO$sR?-9Y+r|%e.0[H%#?\kTJNj[!}BE=gé-F~s:\;+Rԓ×L#NA~*\cCʝj,c҅r{j.uޤPYzuBM qSrK+p:R񁸂F JHڬ^)i<sr9(HTef6m* JI9Qr8t> Viylwd6p%<NP>Hm=0[Z\uɥoA69v)uʢ\ m2D7 ۞N=~DU%/-.!M8 !sx Ϭdm@~}`bT*[<%. #$dmZCDۉ m^R|GTӨ5Ffm#dp#OVOQ7M.LnDJRYA(!@mOάU׷qCMw |7鯶u.':Zܗw9*,D mE=%$ojO+RU:`9ٽ( d82Ж5a JQ'rd*Z-EkX}I(9)?O頮.:tItuP!8W)R{xΚ[±LJSLK$˜p{Ɇ)JLBT@Q*T9I$VyF4j67W;*zڬ{3*OZVyd(qvJW^(%m SwRBKV0X%XTxHڗY7tt[A֧IˡQaC;Ҧ(yWY$ptXy_nUK]>gۍR_Rm@p^$IT~äã\ztrJB F$ryL6kR庒 w^HQ'chIې Jr =.S!ʓ52^d6 |~o}!ܢskrJ_>R3άNm5oˠIE?7MjT}ڔz^z /ZR]rIۑ::6-"d }1]P\G.)H/aHӖ==dزWmI8~AmI9_կG/,tUJV,=ũD%n$R8xmiP͕5FY.R vRHϿ8ӆ^mkh%̟%a%  r}x-/~sT~Yj9HBsLIwU2`Ҫ66*LpNp=ՎY+$ VmmʬS"$48pĸyJ°r@sE`b<1=&RuczDA.:3:^٤ʹ[cÆp6kIME՗}c* qp54T`]ջU)A@[eRA p$d5pԩMQf5ݥ_[K.Sl6d ~%v@#AX{ I2ܨbsC ALJLjwSiې!|;y9>.؈2 d!D u^9*ZBPHRFpUR^~0S%UeG̈́A8<:NVDIj})S3t~7$sN@ƱZKٰ%BCJ+8i,vs8ZQ(huvyCP}/T.CPX ۱DA\ttQTz\T mJ9oh FTHPJI Ht+]BT9?'._Os"kDZKHʞJ$mŽuuI}u 3AJ-Z~M,Y-9!ҍNՍ88SKV]F.d"X}iR;#>OcH5.Z;-*{$nc䕌`($g:mJTܚ׾\. O+BNO9:h}9֜Sju8EC̈́ /3@5Gg+GB;UwR)\\]:B)DPwRw9O>/+ۧwT]ZRS8W'GE`֔IiT6j+Vw-*$v5 _v>~,Y}/BVZiXN|cKKXf5VԛS=~`i`@HgtHQEZKD[J $ځ궋6\BHqU]&Jo j0 =)88Ϝ%NUyB#IՆڈLnx\u*^$tNtWVKSx4C.Kv.By8#8#:}S҄mtѻKY?03)!IQNJCTznfOm6'-˜F)\Ť` |gӛq&),[yȬDUO)J{ 9-zBz={FsN6%N<>asO9K[6{е6s<8 =6L{tz)2$C.qs>y]E޶̇@Y:~)' Ϧr8)7 .Lb|[uzo:H( \-kaVBԥGI#'5a]7lWq10-ɕIX%*RP6#KRzrG;fLAE>*:ҩvB?)5 WTqF=| ( ]Jw49ʊJu"F% bHi$xsU.2(JG {cQ=n=,NO}ej ?ԑm_9m2qg>u'8E|;*=+UPYBɷezIB}j\Ydn͑R]Dl1aIVZۼc]F3*JTZt5̑!Ԣ7r uGMAz[c2CʔFxW񧜹R=.j:R<8%KHyXTi*5-6< #\c{Hm^4)Rf+hu_JFO*NPY^gnD=FϹ)Tv\O+ O\iAYMp.-$"o{Ԟ |gx@"SHe)SMHps=V M%T(ާ1@5,A?\kua.pmM`d ԍY??+r|1XQ(72ݫR%b۪O9.j< n$bV+ =ϐjCʒvfOۯtӫYWx-D*kyT)iJPBVIq*u!MA;\SU< KMwu=ZEBd] x@-ʓ$&#0 qjp"JG||#2 x]l+2Z܍u,c%\ l>xSU4*_~9Rf6w?NFL~tMRĦBTԬk֫fԡC֪TւSrrW!@ '#xGPhROQqo!RP|Yp{j.hJjrʂ@Vv''I=.|5ED}j5[qA d ^\V˧M& 4a Z+ܭ?]6+5^dEXC9.% d-ˊe*m\[ԦKK2e$A#:fvŲ-9y/KW L"\vi})|Uի+64{ 9 2$+S.'%@py3v>R.Y5[ b8 IQNxI P PnzQPwK.|iuPI/*Ac'tIz~OO Q)m #ϑd\tkm4Q^khPdiŖՓT>ڔ?Nl2R%\S*oU*CiKt҃_ sCD\\ƙl7qސPN By>u'Q-Z&1\% bRVQ O52iY0T[#%U(wTK!ÔF=8zX,[6\HS`TĨ}$gU֝XFRn1V'ԭyA>tn߭RTy{{>^Y)۞>K5. LWQ]A.8#H(fŢ 5 {IdrFT cq\ͧ zMCvPi+yIQ‰8Ɛ.Xѫ1c3s/QgIJÛ '9}(\շSzE֭ P@m:xSwl?'8y(u t*SDxO)L/MUis_2n_}(?@;~r&.T9V ]9Y_ɉMD 7I2Gu $\(܂ fي;eJߩoIQo.e"NaUMJZT|)' y~-O7AOcIx&+m'Ґ*H}tӭuEƏ"*#,Db'ܼ cʓ)Y޳brѪ7zyѐxh6e@oNI>iOniH\v:ۏgvԐ4&n%wn,DTd)Xʸ9-خIBBH gy<{dj-򨗼W-dֻ|Wq%[PHP, sΜ%ImsSe4ӄA+S ]V)1qٝQrF9_UZRe5M{I  6G9:-J]ju&neF-)O}ңsB2NubҚkME򒆕 6jR@I*)qƘAk޳GR_C!s`KgmPBd2T[Cp|.Fu]MVd6s#* ^3wp6GʫY[ǚ.8ZA qϸ)WT[KMAhTRܞ@LY]1RdR;_o\2W̳M̔b_(JH8PJ5uBmQ)3D918Xܡ0ksu)jؿVԺ;w:ˆVpN+-%Mpo!) 4>!jU[IbKSP>FVTOx98sӾlVkRo:A+ar )e(Tuv)pWP6'@<34eS FewU)tX2N@ b"$<HNJnQ B^KǓW*,b>8WiJoS )A H Zp@†H#lrPM!3ۇ[\D;JTB' *3R)VQ>xŅ"}&m؊ n<å'# s:KtΖr3 sP Z-\~#}1zmuvw:LPLz`uFL/ knCIh4y?MSW:g;K2YqKUqY($2ߥn>O_ Jmp+'".&O|IV坙01FQ9GO? ho+LӉm"QS xƘWB)֣Á"FPp@rRA cuibR ۓ]m$@%G;R$2~JnwJvC ik!_½4f I)i P\F;4ݕΓoؗPfܝr#XSo_mBJ25bWWĻbYGR-VTWR\q@)m #b 5\zL[7<ʅ Fz}*-.ܦJ3JTF϶ifKJ/ .)Wk>%rYvl F^\G !{F6>L&;zHҤoEJQ14ua"#-,Dm[ۇ)O>ߐ)[c .DCA 8gĩ- \d6GPzyuwFpGcUx-)AH#C_W-u)s@/:S1r,pm 6䔩<nNLUHhVdؑ!m[c'ۏ~9֋zSr'¤HkXm(9c>ςF\ e"qæV&w<))B2@q Fڙ.ܵRٲY7!l9a<u4|FZOϪ,)hqa` /r >sǝE-k==kȢƒ#3MJMXm  (q'\@ \ވw QoTYj<.FXOJ `$Nqͩz"S,i/S!:ե%PpvV}Cj8u컾bT jڝUЪz|4''i+yˏh=Dӌq%JKAD𔁐TֺO}ZBPǃ:w RyBpx$Aә![DuW5$$Q* 9+OKXvP"?.#xܕճ<xyy.w>4 -V7%MElAH)IVNO$RV>-wo >ubIRMfB'%}}@5Q5pCJX:DQ%.Kt%[ V6V|XWnUGWljLDv[ P#rR $`ߡm2MGME1]jKgkȓ=ܩ-[vnzkusSS#jrD-!kݨT0I8t} 6jmm5h*1&Wajr!J 8'::UXƳQي(n YJ'9>15SyU G%.Ke8Cj;rIΞ5a)hO 'ZP`ͬFU\z{K4A=6j8ҩup&2ʞ <{c_>DzU۴X.TG3٬}+sim ci>Xz_̍L98φ hJ`?Jxơ*DmSRrKC!X_>s=9k=E0$>%eN.:JN8OLX%3/gbJN쑒TMMOmJԵ8*HAJքe2,5ڕ yP惬Nl{dq;Dl$]ty}+[#(yG#XI4{iuڼ:jL&y(!ǐrño1S l#1{~tFOz6!)Κ℀Ӥ%, УOX78܎ \+tuo|gD]k[%j<G`_f:J}SDSm%%+ H݅pVu:%z;m*1Rm.:ZRdtѣƍs $u^#k4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hFɯX&G!$WG^5S}?uӮj&9TįzįxCא" Au AthѣAF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hF4hFeu:6_W\?Sn(H~.&Yk?W|okO:ֽObwS?K2WGa5N{Ӌ\J~FC9~Nt֍=3+qS/H,ӆԾډ O<DUJ)z$)PIZd$Uz{xǍC[3iB'v)VU(󚊩qL`p\q` u"24WB 6{*Ƿ8oL~Z 2S-mH 9P=1 f\^ZWCX9rPmI@'8@I$W^ƪ5Mne猥Ge'QJЁ1NyǝFͣ!n]E쎢'#ct4li.AܹJw8 WSm*Rаyۏa?O8T(U*l*|h/5jHJ<%%|%GK֣Erc6RYN@r:[IDSfDʦ)STG$c:iՋXdY:])i59ͯ4iR@u+{ϸ88s5J+Uio SIJpC^["j(}.wOt3*CnBA;ԢWtZa$S .fu Ĉ !=))q@NIS-(;n)JߒAƕU5bEiG) GT|iZ^}M"mSق›mpcMR`*6 (ږB3Uυ~RIo0ص4iM~ zT((~] F@/JG9EjQmeSly_>{qY=wΙ=UiP KJ'Lb!abe~kR$Ji a*Ou+-5BkKIK[a*xH앇8Xgԭ'(5SK&pDFm8-$qykf=ĭ/i5*N8KqʾvǍQފ”6(,v7Y'8ϑƖfCHXvAi^y~58׵+&}~cԠ2%2RTJ%Dpqɯd&fEVTE$,Ɩru~7%G#ʬoL)UbR]?hc ¼3/ΝAѩVE[&dj+PRIG`I]VQj]2$Y,4S 6ny +imӝm0zx%&͉%6i*$1*j-'ݘʙ /!69OWI{ ߅˷"NgS$|̔[/J%d8{uo[`]យBeAJRBF9sgnbR-)Λ MTR)0Rkϧ pOQSi%-4?ڐsGF?Ϋ"JSˣ!Jp`+9U\ȺܨGSUvз Xߌ<j\QԽuK.ޕy[z]Lܒc|J}^*< Zt \ڐ ' q`7+ H'Ff)“&LEln6!8]= Sr-=JZ lR$Hc驎߯之% we $] l Jp'bVU?CBc'”i%X >g?:ň͢ر /8O2C].LD~ws֛Wka3E;>r1?QkurRL-^MeTr8JAC :NPpNqGu~L)wj^S UaoHY ! nBr2Ցtz[M9r S)qM4(H},Imx>O(F^EBb1WYCTUGU^R!ȩ[ʚܤ _l r|kDeJCRJ";9ό`=΅1$}LۓVR 8Z_ pcuRtZAv=p>c:_A>ҳ;/cɔ*DAHLq+uvd @_gOhTM*֝˹TIuh)O %J*Rr05V|x";)屺@m,ez@VP;N8 rUɧۋ$-Ovnl$9ΘVR4Ui8yHTRaN9$D!B-lz=Qb;jR8*NgZk0g:MsTUSGGQXv1MU=JK}<*+kؾӉ?ue 2ɛb ;_; ") OJAZŽ@ Tbۦ*b㹱)I-JQJpyP' k+3c-HPҤŨ9gjH5b"uէ[j-௸nB;ڎlnOp='Ojh;6>K1p\qI~҂#q"幺Ժ HhA֑ߨI־J8j̉4 r( %IԤ!eK$N=2HOԛz2VٔՓ `ՏQ8E|2}Hu5u(Jf̯ZkLV [.l$~INZnڝ-L 51^i( =覫?7]Sa, ۩`r6\c߳~[+M'a7.Nѹ엓ӺT6{e{j!Q߂q(~̩tmz9?TmJ!I~_ި.6Dyq'?iK  8W3g^izYr _ɍ@Jc8gNV3 KѤ2Z5\d96 R?iʈ򟕄J$Hٓ2~ipV[i*Ǐ [KI N$m9RAtɔz[a<_k R $#%KQڽEK,رCm+ֻN#M5QoRIZ* :`RSk锺}%JvRҁOݸ]Bsƥ(0zwF6~b*2u'} ĞڏTT}H^xKi>23ݹj$v߉MQpLi%ң''c#88ƛPjM.U64`_qHVOF˩IUQMHتN6(P<:(JCr4:܆\C nCjq'UN<)7M^Lz6'Q{`T( hq(IWeD)@IP@ j*UI*U3k/jfQʣl-)J@8 M-7+ -m zCwy6Tj)w *ݧVERe}ʄZRy_ \R'P$`q] i#Sܧ]N7;W6mBfEQ-5؋J~{rPR3?P4hUjc3PPu)CnO!^yMKßdSw[%6o{$dg/wy\Ŗ_fKML\u"dRasc2!I![ 'zQкk_ȶ*0 -eE8qWm?z?}K낧:٢pⴉe (VrF`uzXz3tVlS0aFB=U[! ?;UaBíŊ6)%Y? ǰBbD}Ej"QT"d4rͩ FbI)q8㼺͵%QIZB#! +\WNu48\W~;lTFj8=S>>9% ! *]C_k4_m,SLTM`s#9H cӞ;ZK(I;N(g}:X~֗_mP .)@SR gF86a{6jE%(XH<{/gBiR )£q.UD.1rSМxkJGzOT=[iS\T2H@%G#: St"-Z4Lv|Y)d4T H~rp#'gX)j޶6 (m8Oa<~~_JlǰZTeCN ҷ1ʑ#(iԥÝWJܖeH<qEIiRiӊ^3{n}iDͽ'nr|~ge]%:-:#0*HZQ־Yd+#:qϣЯC1vKd $)G#$6=yϝ!.j:7)0qJ$o{iߝn쎺Z]ŵGiǩjHH `88:4ΐt㣐*wzUV $BqQ%|@sIR7$xQջ|uBRaVC>N|Zi (%(_u*8+sOCE\{KT!]39^mYH L&̰-ڽ*0>BZ' c#ԙǠS~iZqOwYA''Gj=U2Y;N%!J[$O<.5R@C}R9JƎxvn]BQRAn=9ƑR髒iCz>NpןTƁq˛ 1h} ŠI'zkϪ҃4ךm R6 *)>rfSHDjRv0$ CJB6#(ci.iN\ƥAbBd"Kݔ G9{iPNnrYsR$=|ʹ,RPzdմ3X+p?)yҽi*P%\(1_tVxP䬜`5{Ү}V)ʦbc SC)Qc6XO~ʩ.ܚ\g?zICbPJF Sޗne"OF"oˤ%jq6&(qtgXGVMV2:S뎵=Hxmʆ}[R"S}4HKZ]DG}T3 v &49R/wRTAW-VEg+} mJ,mJ*-x)2x|2%%qں)ȉp2KEE](rGI#體w2] g\U]SkWHM+m$CqҗH -䁂r_%oRşXii =~yRϒUۏOìQi EC!;DzCm9- t%Gj}GƜkҡ}XS7c[M/!tuaҗ [Q'a! Oc]liH>LvÉ^l9YFp gK7 xT鑢PitIL”׺POR:l!]ŽH@ ' XS-8TC`T@ /( 8WTGrFޞ^v2K{s$GaYrB29W4V✍j)U݊fƬLW 8$i&ozԣGZ ^B.%JRNȟ/4nzٞOҷ'~^gmVDYiĆī$EEAXǤ jJ[}s)g[n뱬~"QWl40j7BIH|nޣ| -pY~7RoJ}T(jy\6߫js'+gA(oSIa5g%&Jl}Ϩ@8L-)RH%&D$emOymM%j$\O[Fڎe&l$ݞJ n; x<feֺjʣ2tAGl6c].d1p*3Ν=4E1*R)u2i4D:@8W)$ƗdZa*Ja,B ~y9'ΥJJR0LqH}+^N?y<3ʽF=RukԿF6]-3ql86rUMC+s4<TJWWsLd  Y9HO[+Э ݾ2{ ή *B}k3)/N[E`[5H5Hm2rUHy⋠6P"&:ИZunNHWmB!%ŐA+P1SjsbJTI@H#Milώy+Դ)?i9=Ēd5[F% iBb)Ȟd ԑ\㜄>U:U!_qOjZHx;I>tӦJP+0z1Rz]zc H$<&U}ib4po6|6 :Q~B͠WQ!f&\SmeypF0<JaRe@$ 0UqJ4֧m]FtN]Efd!m>>҅cp`Ez}=d' PīLk7jMeb*=F5:l`=-/JsC V{xժSca2̥- 6R0ब`y2F)(.- MBm†|IdHR[V򦚃)bH>r9:{&-$k횭Bqԩ-P+IYA x϶׭ltz{~07! x%9-( ϒ8+}b%9E]6+uTr1wͳ`GJ{O"-!iV ,pi{QU(W-%l%% FRs϶?]tQ%Z<İx@%<:C'ͦDm8 X =D/@?^4#U)E&KMar Bq@3k1zSpٴHZCZVTˁ)HRR,{ qnV$UW Dj圔ܜ,Fq|T˞Re! ̉-%M1ϝG}R&ȢۑCsSKԩSv+RrxϸNs˞Az1d Ҵ9vO?Oߩ򑑻?MWܱ)-Si%+uNJ)lr8ǿz/Rڛ&S/O=қiA44:SM*&:/9ueEz=:gicίKɵtxv4&*b[A'jJp f C/hJؒ>mQԇ'[G~;!*O)A('N5ʉhFu̚v :~_9iZ*5>ԩS}m9? P[r)-Njkm[ }-Jso6 9>R헐Ժ:<[Nu!(sI3қNӪn% AsD [ݴz/j˧PM#HGT5.m}d u+H^VV=CkBo|eYJH ))AW[JEҋ~L)A< rI9Z2Qd]2:Urwjrer)Oܨ3-+IlmVB!r\T_nU,?-E $#1׼߷N\1PR W ?HgL1>R>lm$FH$qO-JPRG>ڰ?gPnpy<0Mw (<I8㭄?d[w]&}hRk)[EɍOD C9CniJCm꒭ ju.<(`Ibe3,@UtG)r;Ҟih/7\CnNu_pϘ4ȰHq vm0!=$ OI6_~Ψ7-LZBk'P*^ZJJJI G!t]MZy5^bЅ"ޡ- #yQQAjr@MN]-tQmJ HZ[saWC9NN= E*w|IzqKDL:J6(,IGڃzq}>a7MJ޷u{9RL}i-+!E8V A~+ZUbگx %@F¥׭{i]N)RS ; p'[:*\rʯR넇A! P!(۸$1K*8ӏ8jUG5wX-~'nsOj)q_E/9Od3OG. A!g_rhR{C $RVVҲA$9&yl={ UCqTIR YZrqc8>u𳧽zvhp Ti?8Y6Kݞ5mOKsEN2i4A,`R ԚEfQ2&t̞+gpHH#>:jdO}6ֽے0S CbRf ,^;59.&!  I8X⊓YW6N=Se=MJWu+m/nu„neG$WG=..G3rSf)=)I#FUϣ`ۍL 2\hÉhyq :΅j7i)H@*+J?xFԫ#}'ok4FO!탞4&SA-adRNF9M>G IHKUeR̠y-yW 4u^5]mZjkשP` BNI mƻ6m;d*[T%":mI;Y 9d)j[,&e!!o>\|PfD<|Gm}\n:¤9!ų¤'~VQ;$nVmJ%jіަ`džZ6lڢR7"թmJrkJeirKm%%IQ`|!w7?LҐb.ކ46eKN{(KfkJ$NӏoSq FSlȹa2_m[RO=tە~/Իs6V8ӥmpOQ d<44i-/όr]V2\ ÈH?B1tʄ^p Vq|iIOKԨi/DuIm4y99ڠI?YԖ'6yܤޞA ifLwRw~g3Ӥur䀇[Q#40=kuF$EɅ+,0v&Lx ǫ#qO mW#`3l}O.9ZӈCrH#%*qL??e\G*e~kgIfV98ZH*#Υ2ޤI|u˜Ġw \W]Ɓڤ ?w,8dUoK!l>y%䘊nFgT9`HFofu!anu_pʆH ҽ.J1Q.Z>N^ԹO"GiL(r}C]5*-yb8u$j,N6eT jT)- a9fyUD ;TCJY` 풧R3$ciK>*J @? ߃\UZR&BU\4(c pT*٨)!CNrQ=i]QS%;<`ر@hH< `g{k$h,:%hI@?vlcSc)sU jUi^Z1Ԥci $1rm4ZsZ "ß6 +g)[l ԚO.8meC$epX@)e s-sRWie%M˭R'p?5/Rˎ]ZSlnR r6mSXRZHGcq*B/}99qL[ ya E1kqzq/[~diŵZKaO1:ڑtrcIǻ$JeNZVBG'{[ѪuY(K19y$ZF;s9'>_V,vE]W43SiVE$ VJK4%%7`}Diu2b!muN+NOy癝0I.gi!''a`TAB9' )HIXH Q9AcF|V]0Tzqϩ_σ-QёII;3 'hz˖6b  (ZCShݻpNÌvv O*>(a׷2TrY)1i:WdeO\BK/LN/ lNvଌ}J]. ySչU1 JbSsI?B4gB%\C]L/ɯ5aO=`F~=OvKueʀP?Qq;O7]:.<#GԔ'H<I[M6Ԗ|X/RjuPzy 13OQ;M*H RP8ʊOݿTN?DBjttI(.)| 'U:kW#T_m!Þ[. jBG  FjFOP)7 ӋD*lܔ֊cl`RH K]DghN遴񨾝d{VyN61E27iBzU #:tC˂ӨVb\R_[~T?o8jZ1Q1@jzcZM,JVI |&o5RݥR/UA$%9='z-rL\@>'JjnZ+mm,d)< sq޻] 6ҏ RhEJTuowNJ:uݵM6H!U 's`$`rG$8$ jTJE\KWwhԨm)?^}kTKm3!(r0>4iMcSk0)ΙRڧ钩0䃃w X{ȫPk{Qj6ž6N1:%3:Zr}6*tHU ZoLLnuZ71"RQe.=1uPN䬨n"QR:]K|8X59,3N4>ae]MmB*]l5iU C!l'j_ٖ! 2##XuJN@Ml>&)Kdp<{t4FX*5C%{OJcS$ci+Q^@ S'PmmUK.jQ=ĥzJ]iG(/8RzIK)ؠ6/"T@N :ΫuUZ;!C~Z( d\F[7[){~}&&YJF2hxO񁌌sa$ 6D&LsvUv-K PڝX(8{N\:[LE&ie0+j4x~cJW FzUISݻ- *Q@(O!^5HёfUm;jdHn2hTIt߼يRUys2҄: g$yǸUoҚU8MpBqϤs&èsj؁-<ЯJRI8$y9iIy 2ʣ*RR=;v Ns1~֬0'Pw iS6?qʣĚTw%Ű71gPOQE=,Z YEhViե8I@ݴ(i<q$MSWYZ˫<).߭n*wWLI%=vT;r>"[men-6dZM\IO.L)v{9NAH$if˗*Stu&kxJ*Ia.&SE<%y#9kTlq7el@PH>}p4AU쫝mje1.6~^0|4}RhH~$eqIj;'PiC R~Ye,6SI`s%_qg4DrX8) uƤd)Iv{>5S,[˛OIRߓQCI*:B+w.Et* 0Od4.IB}8gFo_-:In 7JM?p$m88JWz+6nHɦ(y ;IXݜSo95 z1Bb:ˇ!>ԑ Ywc{QIRJӞ-MQq坝;QoָLՈ}kUnpO8տ~(J+T0݂FR2:.GveuA躺QaTKqgq)h5T2Tx΢گL}>;\lf IFskGCC~Ƹ gT12ɤZn4Ȝg*m%# {Q'+]h*/XI.ă]l=#i Ij Q;Nܜ bneU!+so AG9fUq)$GSCüo?S3ύKB*_G[*io +n夨4*. zDrJqpA|gk]hJFI:ݟO "E*3RE R>VhWqښCȣH2[C(#Y g\ނurWpl-j@}*]opmQrV9‰keQΚʀS3bda–J 6`릴]Zک3U"K$YxV[jKD;%n|V}?]I?cdJl)Dџ[$ <|3qTnڬ9v6JBC3BTRK)ʉn}:C-T%P`2Z ߄Q1KlThd1"Eg 7'rV!$V@Uz< ҥԉB dvNJBcP(-NuX[ve(kmҥ$6mF^Wfpċ:4Vؖ}jHvs<.Zp#\3+*W*U>bS;'(JAO9 Agn]E1iaR]K5Nݫܕ] *%&)QJ#(qe8Q䂯WCy;bݗ+n"ҼlLvM2 ڒ!INNF6Bh?gSy;zazۃƜҤWLʰl (w+p I-XͳhYWMf"IT쥢CN-%DJF3Tҩmu+]5֐"R!YJFӌs25 ma RfP 2JAJIYQO= xmܠyYƵݯ0_U8Hx5(#K'=ڇ(gqctξ:3QQ @d$}rqǝ*Ȕ*RmnBKva!(I̥F8g:zönUnYzLK0q4jUj)2vO!̘q>A o>嬮c;.j|SPi-Rrdm*%dsO g:@f&ݡ-_W¾$~i HHIp,z scG wUXo6ʷRW}Ǟ[}B-{uuDttPrpp@@n*O\(1.S|lBJN3TnDL\ɧ4 P-99NViI4FH!kp=qnig;Qea%OcU.7NJd]?H΀iLHS #r9hQ/ndȽ%-!n,$$+)puw]ffm>nUJaZK8NU2=ˑ:U:jۖIM?&2Tw[@ OѪI5K:TIs9ܖ?!(Φ#9;V<- uTެ)i}FKHV9쑅}G9-K(\mqӴJ 5nFz=EiRRیm%JQ۔U#\iIlR a'݂%Ś>-*Zp:I8 ~%ɨFTXqۯ!.2rH J4g- E>k{pxNNK#UX > J oS98V-igymVU>FZ)n t%*S•cc^/\ñ1 #L[iBRP(p8::%-="#pA?ӥp<mz`??*NԩkMEI l$>q*)}Uq;V@gvw~Ygi~̷+]Pc%09ZH9y:euUO`]PH4 'Ϗl}9**dƣCU;iӜn$"=Z XA9P:pubtE"&C)8o(1 <󨇥vuG-r̭}6߈#~d6!$F| kJv.,~n)K~)0S$Uji^C <\$0‰5"|tڗqnVjP> 5&TJrKk8ۜ61%ݻnjM.?KuJ-J_CkZYYIB 5cg.ݶt2BkLjtJʋM8Im%- @XҜ*P:vuMiFM% 6+!%`2-Șԅ5MvS,(' P<H#،Uzs.ji\Y xR>BT@Ɯh߻DKLo{aIvJ18<uuI)JPX#zejUnXrQ7u䤩iIR6ag8p6.f\UڻRJLHm+܆r !E${qu_Lo;>FpUK!jHq9žZPV8ȍ^ ^B}mR]SYJ9=wdn)${5mH[ZVFeCRv <o[+!s ԩ<(Nx$s/To _]VHXa)8%(I#e6´r&GʪJ: C vJ#vԒpqqtR*j='U[Mg{2JGd&i]arQ䍣Ytt+BWbiSA{yHlnۉP+ VF RZO ojb65YR d1]u96P Bq) ƅެT)vڎJ/Yi$^|5]Pˇ_D K-ߴ6!@hԲfRiͽLTˑ"ڔN~uѺdjwy6< 6A;U tߝOm.*⺥>"i8 Is)BF{x,|,<rsْ*sKXyoHZb/B:v)GǨ*%)"w\!]Ws LzZ|m 9NN|i]5Q7ER[dEv@9O~?WQh*x*\ fیJ$X~9E. %A@qλ˚+? (%hm d!g:_'JoFd5bP~](8<)!LG g XiHL>S`#_wuq/sZ6Jr/:4仵H힧^acnprmI*ϾTzpbS[7|R{J׺+S~ ,g(t"vNB|AROz/, EI%!!9'SSR㔖a@| <+YoUE{]eGZqy_#]:w)[\*uڷ_YWRZUԥ@G(m' {,*RKs>m 8O9|j'abښu+A)#>$K6èNGw{+e'p_d7%:kJr>`8z:hF~reJh+ٵR=>5/GU! DH[,Nº: i‘Ni,̨IJ5IϾ5 ^IEBHAw}-ǘSCrTAF8&RCmYq)-2YB9tdk` ﬇#X\KS#"^kr#Z0sthѥF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4yIc.4UAO9#~ZY#*_ 6$m)H:'`ӧT.YPܨFF -))J$烞4ԕЦUO5Wj*jr*켚!b'}1[p/aJNjrNΨ?wa}%őjI1vJYkS@ SFzWVa6~'}/ym*8XP'1ѵ!Utݏ5y-qb.5YGp ڮ?_ maUǶN傰 B'!$}INNh4ki>w׺F54hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѦW\?Sn(eu:6__g' bj5s5~qZ^'F_S _k?(|3ktO#!k||_< o_ z;Kۉ%)&21-,!< XZRk1]JQ[[O;qj<]2Ǹ]lV@$cp_mH'MlZUk4Z,J I J҅) I9#: Y8 ޓd]ZaʼmR"F0>4Cl7Layo[C2^Ԩc$Gu2 m5K^*ҪM~W!d2 AVP9XZW_VSv51>5iF2SYЖyڐʂdr Q692ԴekWg giT4#GFb_1oRNH52w!}ū P#ՁLjӮБA@.+riW4'PCQDWJA@9dTz *On1+*#J*EmV^[#OnPiE!T6e'±}U:I])smfnDCm6܌'qKkI ':vXP$3rsɀʛ5*qFoR3ƢR1iSEq PސGN?x]vIN#hqN%ʀH*׽ =cTwPL*mN<jUrGUEWJ_Zb0>b]!Dv)8#XONQ-Tco)@୾ΚcUaufגSؒ9R(3V(eYҖo"JmuSנ}{Du };;+?+jkI4E~BjtJ,ے"dNѥKY11[vn8ӗM_Q\&"NE[ HSI; #p3qީu*U@0nKB0Cl ~{FB_.I[ ~\锢w,K{9Z\CTT˫sc'$c9 />6S-p<շ-nsc0mau˨, 7R@u+JB8݀'h Wt_5F:KNsK>֥5kg '߬Ƹ*y6mŸbS#~Dkܕc)MӎrpT7kj:fMr[n%i*o,BwEU'ͺ&­¸RKC [BË$FNUO9myUCDŽP>uĭ@A:ΙZ>zt.RC?UNcӕ=˒.,KI%8[jJ6SÖl}CڱYw'[r=YjQYz. Jm:C0'UJU,${nKoTuNߕUU9 e*ABt%}ƝB\l ,pti>\iiq!Cjyq;qn#g]HTyP= z r?ZMF2’ ;'viOmRT0~L6G孃oA@:pRovV %Ùr?^n,e;d~]Ce:TgŠO} xPb6[Q[G +I2X9^\HܲHjuq_ʩm:ႠST l+jqGu*rh[d>u`l̴.vGI)埨s9^4ߩ߭hƔc6$wCʽIm cN@ yAs 4)DIkn<G{ΣJܱJ!N|9:[j*ob[uB~g%OJeUqd*a%F3#ҵx N 9h=Bq98г_i=-RVw8uToVRTWR5QsBPÜcR5bmS\T 8< %4%lؖ YQ%N qtvP#ݖB#"kW nxZT<(\veT<~ZԨm֚ڧ;F<|a?lR:UJn7ha܆Z%) GOw*BF2uӉ”q*iFIqIއJ  p<α=]0B4ى%rR';iݜ?N/bs zb,)R3*?+5vʷ%^6bNԕ޻?#ZVWrnl~2tWf#pTkM8g\ U*I 4 d\q7#J!*z(pHuIo*Si|Ґ;s`ĸSuqJAJtzqGe@#Ӟ NRT'gq80qpxӀ)Ե6 RJqGjk;kwG<{ '; oN˫SE.TA5aZ\d:S+ߵ88m)Ժ+w0m vRN):Jg̠nUKMՔE]ƐHTJR'K8W"T$})HOde=Ɯ?*BJ8) JOH8߄n>Wq@j4.:{x %#2s(twDɲlH"5-A^FVwgN5,I>ڏ#q8sS+5Oe"h:[S- >=4sZC|~zNXuթP6w#qg\"rWH?.VsBG?Mؗ.bCҡnDKis{299|kXq a?w[` sMP; z["=)(TRNISr>ҔS>аI9PǸ8scݨv)ą3o~] !⸡;^~@'nG `]R q~y׮%£%ip1: `(v8ƤzolM9Yn$S(+8'=F#DfoOxTe}r+1`d)s$cVmdZ{*.#p#”} 2y *pUr[/ZS:dhE^P8ctJ޼t^rɧG |ژy,H.gП# 8yru>çEpTK>Tp9>9:fus*6w{˝ьlZBS|ʇqʑߐ^LP 3ʭYn_zwBsN|ݧmzٷf[T]KcYԭY*ơ릱 e!03rS=*yDLFGNk¿,Ҥ,ORq&DhJ66 !Z3,JLVMt)~x}BxA[sMPIZwv?8mK1)u ZBF=iu1*%i*LrRI_Hσ)o:%Hv8y4T%+RǐpGSk K@* v '‰>b&Q\hj5W[7JA#>ޯ#UN6WX4FIΜϝKJJ[!)2<`}8 :zgQ9Rv.S}QAXpճ-ˆsKQ<5[ٱ].X\!nI18iJHJ8$>gNA UI!&+@wyρܣHSCUʲ%*JA#5PzcKnMR`ftv.[-۳-Uz;[0$uMt-guq\tқ}ϵ0:elތd>ԫޙn\ʰme8%ʙ.[IP$MO䘝>̏MSkzuS pZ )O%j)V@8:zX3}Z˖~MPI%)*H@V0SfTq"@sم"L[1XJ7d`, `75ݖF\,w"Nc嵔ˀ{L:D"Ĺ| ZO*JO;ir bC/yEP' +%*RzIqub$hnI͸iE+b5•@);U%۽M~ܯ2a7MSc+Jڪ:ݯ6$0r@:}t+VTTB U1*xOy-E(S!|@:މG-tAQR\!!i!iOw 8'\4J=v tU:_ki XrKo(UZnEaqgkR@RZ nTΊ\NmXp&^R3ygI u6ܢOJTPi[J{ 씯 q':&X2-Tx6Sj5ђiENHNNz;S#7Nɥ1ەET#gzYV Ɣmjt"e[횓Qf nN#ьnE[Ny1뢓w4{z(?%\&>^"+ _͗Y];!+*>y]_dTh(ѵUYR[9cNb^ǖ4V WVN1IWfE"])ʘZxƻ3Zkj҅ۗK!n95KףrQy-ƧL+ݙJo *OupnmzE:M^ >K]5OS,n))Ysd`|ynun%Nd{Z'ZYVd;;J+5iuOb!v$7BZvc:1 p'H϶3zһUHXuӎg$e\Ij/R.& *Agh^իhD{RF 2FբR Y;Tvݍf8uLM5no5;&-NQUAta SI:12([PMQm‚u+Duu(QbU~Ƨ];tzAiAHy+5i .sFnTh xؾJ.1Ye9mCh{d<z"ĸ.0!%Z#I$1rJWٱUO?-zO:2 <t>ˬbJ4EBT*gVT@q#VNѩZ ~շF\Ibӣr0`ҳS۠;\wS?MNBM9%{.(%įέ5kI߻k+64&EB֕d8YBHRV9 vY}j,y2-Tʲ8~ZJ܇Ko/?¹|Un^Ү'QKڑQۏ6"i;R^I|]">A=*TGj3x4Zt3媘AqAar<7x9ԇ6>4y촥}H Fq_ϨP]yeBm%JM=>a久sNHvdGnt~αMu bW)e[|Ps6*]E$թ0pX)4 ..3{m) HpٌWtPڰ‹THm)%@,+- ƮQB!#;SI*^v64׀Ou2RbS,,%+R(Rq iNZʅRge.8򕀥/<}ϑƘuf.Hi`i]%6uIIg'2-83 1!;qjRJ|%xn ܩWfҊ;I*WCQav[3@LCN3F,*]V6NKȕz,$7lIՓ߇M&r[kjLdKGr J TtBZBonUyվ󝼘!Z$nV9j˶.Ʈ*4N![IV}AjY >.z[K{z)#8Ƭ,IrBRJmU 8QPT)el*-spF1{WdNԞ6˳.ESۂ:ĈVd$-m*!J*:gŝqD9o!!Pruda*9!)$uC딚OU5zj#uLd Éw!Je![KhN@Lz.:}J&\f vmR$ UZUt3&j0Zcp>FqLZ"Ma蓡nvVW@>)I!'*<:*m" { P9(=UpOC0ީU"F#P$$~cU[PX"XeL-B'ehqMM}Յ$d`W%uQDii,:^dHn=F!P6eI88:rYnaJ|8*3jn)q;npx# ?|ٴZe(JR&G2PA$ؐ9u1VoR`A&LQ>#Og2:wx;O#@>V@NsI aY''Mdє8P>NO<uTPaGD8PH*>?/4)dftwu2Qԗw\Ylm2njZGHn]RML%M`6BJ88RC\@'e_LkuOH"POaiTpTO)9|y>c75@%[^ԶzG<01bX[e i JJ#27sY5|FDRFRI|cU5h2NVe3z$RI$VNdMʧEQXM[E-1dcҔ;3`Tb༶RI @`sgNRXuʂóB +qih%DIS]V8J NJx]+P~ ()(/ 3NFGUVJ&4)-)HY_ +ӏbNn(Uߑn>*c$Prp﯂9>҉k)>ب >TW=!>|j6a D a+ma}F209sƺ)& 4[~NS7zQ A-19A dcI[43*SIҊi ,>Tr,$HslS5LT֒⏂?vjq0q5@-YƟH9qY} Tpo=5e-.!km`ȋ^`%+9*#1ztטyR&S-w<ڻ yJυ8$.)k-'#ԕ<xxV}ZpE1ɒވ쒝ROl6}8im18J;Aߝ'Ʌ) Ti㥴<@Sૅ u,tӮ6go$WXs#Y䒽q؊Ԃ.#Ӊ kRB.3t:6&Ŧ|wBu(X xi'ב) qjݘ_\ʔRˇrYpSH>{p-MޯZrL**% j}QԜWύZh/_[%.3yE$<uun>.\49,ͳ״ 1^H1Zĭ% q-۪PW`cnYi>]֞K'?[IN@$(q7-NBȃ=#emܓ˅4 >}'u˼+e9bB!E+S$Ph$?Ld$Zkr-`ϋc[)jn/ףF$lmrR0u32URI.5\# §A)IBDsk]W~{nɫTYNml-S2OGmoިHVM iiZOu/z@ gjI:hZDx嶥S%;G`ig?SIڏu⢱j Ӧ=ّQ%XSC;w?Ohf`;+`>i%rB#]rO[ŤU^oUjU h,Hmj!ދa–ۮyJAIXy0slD:GD 4ذIh#vHSIBDB6莀Im/9:Tл\"OQ\֐PJFHsӲWƗQPn3LGmcG:eU|[ $!)?u&ԩטbD 75)!A_V<soTwLh7-/79a*ETp8R =8:U>⹺imTQ>&K?A r7oi# 1u;)WEv ӘQm'*r}xV.c;@nioϔjRI?-.n 9-2}/ȭ%xQ Tp NAn`"M5SjIYVeFin|)뭒hEkT ҆iY {i1KQRFֲTF#ےyՅdo?}μ. y/6W6c 9gq!FԤmJ:e]8oy5[0t*\D) TNB >qwڷ#rJDY **m)›[OgETyu{!Io>yoqIO}1֪߲PH56aKKC 9۩9ؤF3u tm\$~,̈i72Nr>5Un .,'V.u2r{2+dҘynA'QHLWE Se]dEq!!֐X O9#VMLNTjrSQjSRhNRÍkW:_Guo i XQLt%\}Y>NC aG##_+.,RzrETOVTL zt#.~!~"5hwkio%P (33_6f| ui-\Rpo6[N줆ҬeE*}y4%V[.Ja-8Jʔ $P[anr9*>묃HWڞubJRRՌocœ5y P< xN:Pw\Fwc^;Lh*B?t$4hѧm7% 'o_'k[%$n'ǿm4ԕdg:[K+-P>>CK%wy^ƽׄfk:r XC`-\^gsSqqre1"P*j;mOcWMK̕TPsvFxq Wi,΂.zёqoo6ʅ@JZ 9>H-Ewﭴ=c :ӍɨRNQNw@9jdJ G*jt8~ء뫹gAѾX-ڱqjݺܑQ!e)%2k8Sv;rVl#'J>:]ըw2Tu}!%NҒ=Gp<WqVfVw>lc-JfCοo8S* U.tjڄ2e2ۨ <@_oj"puHԂp>uuSBhjAb[Bm!JR#Wh3MrBhjqE}J; v(ZV2?#p*RlR$ k gS[>[ ܰ-$8̇v<\l{TP-$†5FsZjw9kbƵF54hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4iRϭCeEvDGK~|q5:=0ifH)ΥnvtͳN"*Lr$du*>OR7xy_=9Ԕ>k;jRwqV MvT/ldgs:ZԫeL@p=jCh#jPx Wf%}TÂv%MTAZ a6nw);`jASX Fv#j)8QJ$y)|xҷ.go>fU"K(NH$8'I A=LԤUQ?٭Ky`}Χ S;|JJjS{E;KTm2 l;U9${j B)?a7>V@0JJ^%6NJ,KP!%A}N֟X7 )}+Rmd:G#sm3YYϖ&;Mw ( X=𪝧U:"|4'\ˑNHa-^PTvڒ $p6@zթVufکބ^=VyHmEJV#jBӒ :kվUw?I!! H~2ќ) x20tFr 'F4hѨѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF2Cu/Gt+)?RwV| ?U?k?W鬵ɫӊZO>75'LZpZ^'F_Sy[#ցk||_2t6FB%[N0ZC*먩 pg RIJ#'<Σ;z]J[v֋>yE)PԄv%ܟ<McȮCPzXP $zP@5 +)%vIqD@@,dtT:e@aa:Rs q.ֻ.?" Rz+I$럨JǸ" 6b-n,,mʕJZmn̉ns-!۔Rv|`Iƞ(1}2ISl)W*𑰨%@cwΘV J]jhQcw$)jYS4!00u;%R@V=*P x:YW,9s=8a_״NwT#G<FL]iϲTqɍ<FH' hfU҇(cT:FV!i91V:kxխ֧UoZ7MAkd pFtrӤ'Ee=%Xr1HCo8RA8%XI#:zӾ.ӑWPm51v NI$qjTGO'4nJ3dNh y):w$quZuٹٴꭵ)ȫTj8TH#=gZkT.i2%ΩZ6&PiW5Y}$"KH92HqNW훚FD_+zK}EXHlPIϝAў=hM 4V=Nڗ7r':Y7u= Sb{!Ą%8<`4R<ӟKǁr-֜qhyI*A:w3~Ӯ˲ 40CQNAp ݃?cEaKb,r]j3*$IY*hgUU 7p',&J RJ]RyD$8XRSVRV+%[6ڨ{59,0\#䔥E9cwwۂ1FuޅAT`U4Vn:lp:[8οucuBU IXiH.|<|jsRS ɕLv1fŠ74Ca  >%>"TѶ1*@ >?éf[Щ0c8uBzq#m=[`x:9siQxIh72ɝJJo& >'xGZWrR>S\:۶njN8ԅY >@Qr85RP*-qqKrߌҰyjJY 6,.X")ݤЀIB²s- cr\qk>MKd6cyoRHun:5,K2[TD mN@mIgPS:3a\.UjTKqw}~k CڈS)Q;9'u ׬(-)5 vb^ ~'pQN@#5S.su!H}8'q9tQ&NWvhM;h-]Ab$jiSŔTH QJV9ի?GV&߁kB*@zT판Ҁ{H!K)IN3.E}AP; ֨NN[M~tíWYiϳ.HvpT'2['24P#TL_f?-2KjQ!$mN uk-VڔK i!1CR^6Y '82i OqiNJN%;G5QNyːar+)qbSEKc2u9# \posIǟQnDx2WNXa ZJ))Hps(|@ږN<Il"#ie9qjh}YD(Oa/;T;R>9@iEjUІTڙ'-9?xƠ8pG׏?NT rZ?i)YN$sˢPAiq#~z=okkA y;O'KP`.8Ed>8>҄SM̖2ӌsm<̻B#}9ֵ#'<`qǾ8u$8ǏιQ/vR@ 4f 5P)I @9!'^|o2B3yҽL:\f PRWA6߮ycm@ Z݌{c\ 2% <[Y}4PiIq~aeM {k4GpA)Ƅx`ʔ{g# }I8{k)۝}@G>ɨ~+<҅m& \z]Z 9eJ8>s5)anb0>Dqp z5MT 첷3k[U`C`;ʊԒ${4TɠL e脳 BH q'βLRq2TwJ >eY1}ޔ'~BRJW҆TcGEq.4V @:ܧHʂ}:▤aN,%>PO8$H\2*v I>xҩ20XK'[=I<?1cHVmD +$%E9<:~&i+gP🌧r9jY8Wbr?)gJ3YyO+am$xIǑ $TiTa Jv7NO021iGdR~CXy:ATG?C'riB0rxYrSR7dku Sjt)׹I*- yLHH+ ӠO% YqMFsr>uU:DB_i` 98㑬2dJkP:1>= !ԋ/o.ꭳY¹N%QߧL[-^lz\gg"۔i%R'h*)))#'~1nE=VXp7>{Rq8 qshM4hvSB!o >1? s$(;# OR&SmƟjZURwTq*R3p8U5䐴LrP\'jӄSS_ӛ7xV$6S+tFBRNHsƾ $@%$q"_jȊV 4NiOdd`q߮(=žU/#!%~9NT*lG5m#SW{5|EDfC mx'n2 `Gt$Th鸵jUR-ILJUdlOi}vOb9q>CI%@`G?]KAa{}$ xRT@#9-)lZA L&X! QՌqm@TT &I0wqmAz IHHNFՑgqsM+S¿39Й2WyaPy}$ ],%.$8H8$uY w&b~K*J[J{J* QYRʒr0=l\9=0HveJM]-Qp4RyJxVF}Rza+v=vE:Q HOch@2I?6-+1Pl(?vA!{V_WTT~FjCc>ˌBS}GoxUi]~qta&hJ -(ro:B2V)rPz|xcJjbHtAryΫ]_6"!bS7u7έVRSWT|A.1][Ǩ0(~ϤsO_CH UDRBd% ݿ$qƩ%0EEQۜ,c }e"[eK䡦D 'Ω YHӫ޻zViѪ4ijR(N䁓}O)Tη"r4H~ S9}9M*\N.*r9^ssYŤ%ityRB{[gbT5$28m*YAϫ>?]q7睠 /v>c9*W1i"N 6,8m c9r]ꀥVvVs 24%5w4ma$rCoc]t"njOښDQ5_* rF3Y|+9@9*~5Ta-; !A@8Ӷ֏S\+DZ2j'P㑖G1qBFski5*}A^ĩM}AL12-gƸ)K:Z%"8m;8lm?e|O.,Fo)& N;%#/#Qq:ѳDuGFyIaQ+PCD~7 m:ӛr[L@-1eN.%0RsҭnmTjlIu1ZPmCIW8{q>teTz<ʤ־rP\ #Y{>;.1(c3{n(岎[aū1F73y9mkGU1쥣!AR?=.WMW1'ʊKuJݜ)! 5$!,-!!l-g?1qVOrQ1DTIsqTTI*RoG6>܄$NBf]bL*Tԇi ;pwP8 Fu6~!qQʏ`qR=˞\u)i [a{$VjB:>RLk\W# B"BPDܴA9A98suM[%FfTfr$Bq25&2IC.mVh6[2!i!^R=7?*t6Ua¯HNA`yS/OwjX6GSZ:)M$}5 V<Щ0hKJ/6% RH'N_U"J~RsDdg[6Ree*J`O -G2ZYodVG@NA'9Nv~(TJq c V}YNJp21Υ^aR\Xq j#l5A.6?縮'2)Q J KD LU -z.[,l EQ0@$n v3^C1Mle@g i$'%"sTJSKP8xk[_~Xh:B>t48 򔃜 Fu.)T<ކFx%ԫ$9 Ʀ<4LZ]<)V[mp$gtC~h,E|ée!  f֥NUHfs9\]R)Dm 9 'vF~Λ.PLn8|uRN7!AA!'rujE.䧲.6DlBNT$-[TGe%' R7O>|jI*k0oaQN|FU>[]̞ir_ )Q>'88Lzf.cjdI)m%V; #Ҝ 9:mhڢ[CENSnK#'S{#ztEM3X ~WDQN#f)xHpqMft'6o̴*RE2m$1LB-)rA#rNޟZ ,Z>>=YlFI݅ nσ%GT$uU C~bMv f,7ѐ8rF0qV"ƭ1@!2@qd]$[MUVgur/)Т= rVqj::gQrj3qr:jp;$$:j[4u(nl$S[ =@%J*݌+?hp` 7׻ wP$ ̕@](9^T: sbvqNGPFи*mD-/I#델@|Rph͵t7HچRfۜI .6w3n݌! $Ȋ"Ng' ビZ_+mE>-~]ehS%OrMʖsCXzc'MlY%޾U:|%ʘu~S6` SxP}6+4ZT*Em lmzl $6]ס&~٩{iu)Rv8<:QԚFݜ*XncWvz9F3Pِ'VRUeN1l&HVi9+ܤu]e~sa6@C/GLAiwvЅpRw$ 5.>=koJ!!sZNqʿPJ222җw,s}~v1Rէ]LÜJMRBb#͢H[2 VP$_ -*TtqfIn 8izۀ%G JXۛʣf7Q+ickoC}!$(9*vR հ%tudeʓsxnuoVk+@^aJi6[d9g]I~.54%%mũQRVO3}WcMoX[~1g؊99 %mr9TO&ޥZ5"JOqm!%QХa#I$z&JtheDe--An~ X*Fp3_ )S^esqR21tT 4E)YOGkv_U|'ZU뚫.X;2sV-$N?vDr6B?Qp;Nm X@pr2!:m`ݭ5 6 JG$59J&rTxZ5ќ);!8N@8ud$1)chAH sε)n- -^$Η(ZDq(%*KaY}dU $p2t$Hk`Ϝ $GCS-A(m*Q?AtGLu61g#ϓM"qT8,0 D*A9@J.eE*%mm)ӁYzF}ƗbMz$D% d\ӸAkӋXJ%*P>k[\{ReMpJ\wQl$NG dcK˧>_Jr9J,#7oeJp4m CԹ v'd6 y'>1ק==[,kU[{ ;IPI¿~qUm:r+0uqΓ52bCvoq!IhҰ}xyNZ}=K}aCs&GQo]\n ҖӴ#հ dʪGP$S miQ g`өHyJВ I BbRs aYIAӔ+?]|ݤu>,w +$́$y-c5:'bpJTKg9ιU/xS D(U7ӉWXx>Agςs}ѻznލ*BOq q "?Uu+OQ>Lԟ)T0S:-Jr*zBԞ5 Nם&}ļpG '9Ϟ4\j*K C -t$:PA<mjx]c΀=w-RnEJa2\W蔂uodt"ˢooʧEwiLGmkI89?znс:yXlBDLpׇeT]kjCEY$dE>É C)*yEvu D$&i6#y@'8ӽUQi` C#q#YJ2kQNR? tgaeXA&0uh:]CDۆT=0ڠ8\‚T^6pF MRE҉Q|XR2 i'N]iM?hDY5K#J 6{r"vC؜?Q u؎jW:>oTH(TVPhP.%@?,/tϦ8*HDyd~$'v~x#:q) O6 ZLɟR;L2vˌ~-7A>\L5= am.C6>JO6-B$%J %)~ &E6maE-<7x$/9-?LDW:m@ Ҧ&O^+C ~5*Ѩʍ9ibR[JN}I?:\HRHRH# Ry,ԊFD:S}LM{x$(-On\RIPeFgF4hѠF4hѠF4hѠF4k@z-N\M!ԯC *~~aSs³>M:x'MkuJAk u ;H69CHpj9%4UQ%?vs4¥vFtQ*e,ߨL\㍹7e*FCr:lnk~ѥ/"^X0$ecz7+ҥ\).juH Tĥ% e+%*eIvs+*\ԩMfPem#h r9'Mnוy˝m+TS#KhVm<29֎ΕB ڒL*=;tYT;^UFlɐn\Ou BQ㷀 ơkʽ3(zw`]¤AnԼmrҟ2\Pq:R< dct?Lgťu_{$5 a/n=`FHQ7ĥMZn!ftX*Oz1u!ϧT)ݻ99H_4Wi-b̭ZZRBR$io?5ʼ!Lm0y-W8Q+9y՜!W72%q\J#P;gXt UB/AkmHٝGvŨA_]g5P.Rԇ(Q)ZVF\Y?#U7MY̺i<]VҤJ"P"e.$Uyr)ЕN \ݼ'8{ѭX4z2M&EŔBB2>n}x-m")/ICJ*lqB$ݗ;J}.l3Epn5IZR ')o3Z>%Fm፫HPr=YٛO5PRVԅY5ϣFP 4hѣF 4hѣF 4hthԀkc^hѣF@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4i۩;]paNͺ#(YXMe\M_VעQ?gT[O>75z$tx_95Pڇ Vt6, mU2um0Uc898ҥ iuSmV(+r2#;A8g?bT[Xc2ۑN۫ϯAόg6ӥT*jm*y J(A׾pV?FHbqmAp(QD9 _%!('~EuNn6R'>)ܵvŞ\( :鹺nțML;ZRjL[NAnUƹiV_hCoJ[= CWWwMtĭ(+pS.cIa0g.*[`yJ% yz~տ:U52\7|ar3BhN*DR›NZFJVN 'RCYTLJm$H*+w vFw`Ɔ6a*ʽzM/KZITf`YGmp JNZtSq[P.Gk C҄ɵ I.m+p00}$ jmOߦ8N5/=xc μb]ԖqRKRcJm葕Q%g [LVN1^RB3a>$jVE:-A mĤa%)Ƿ'qC~JHk4[r JrB@֢>§]Ke7*H%Rgms8YaZ钲HuJMv1tje)  [Iq i7(s!Z9Y5\8jrVڀ!ej IPW0 ξrF8n)wQ-;H".WqABQG6_53۞a{TWPU-)}JJQAg)n4ls J\T^`!^S,}qp05Xb$} B~6lX$䃷)9#<:zDmJUjtQN4ӪR!!AjNNpA6aJ*9z\9 e!+dq:2\zOPK"Tšz;8ZKg#NNh4 =X p@Uڙu&ն aaU[ 'j W8 NyWun&g:GJ[e.B0\%M JH$$F4G#^Щ1Ks"\I cV\I Z_4nױo**ZVC?<%-Ynj>&Ǡ\Em"t [nwS" h9 $.2Z)HNIwy )d5&gJdU')R$ kX! 4AJ[Ԥe^ Q}u)]1Ch2M"-A*Bwz8dpA`r =JURbɺ[lUe+fc 4ҤbtXUZm=tћZ w !`(A@wHӻ%fؑ WȮ5Wl V=$+u1AKS=Og\*.䖒%J C8G~eM";)N>x5z5:Y-Qv[FFV#Ҏ8*GQ8T&JҰF>%kNNԊ̘nfPWG~ʓp5Tn:>F~XZL5ΗSR#Z XrBTgQ 8]$'\ \VLctx(STxm\QRV :*[59id 9('HNN2FVB-90b8 vJtp|>*lnz2SCrҨ%9eۀn +G+U4ʙfZYM:D(D~AG#]7Lh:.[F}'zN=sMǀC7[+}Agf^nG\z2S2X-?ίR{8%a]UN|Ô5DiTVNxrʸgi/7RS͈dyWlE)$D^#5e/[*c&5IAmq=ͪxVrjTS19&ZKrY}$$ G `du]We}zjj!HB3Wc[ !KLihL}N-)N[dɁ\r5b'[mGj{p@MI+r)ɖaA=xs}t"'tUY.I6}j$gݭcq}w=԰/y=V\A3JbҤe-[*BZ҂# 8O:O-tg*tu7)N)FX(ǝ1)۱q>Se*=|kE"])YaԤQYlgvAӂLGTw7R7>ќa:Kp픅I^yiKmo(S:ũ-NJHO:nBUL!Ovv m3Ϝ ﵚC*XI<x9I} wZQuiQIt.N3%ˏv¿Zpg\N8-ڏ `Xԑo*ey(^Bp7c:b2u{W=)Iق }"ㆋupp+ ۟qVj0CmT\8!G#9 )) Q^P*䜑 }5DF}$jPHZTAqhM͍,))FeҎ X<%]HQV}t;'Sjyq,q$$ddxCp_zeIFG*&@CT%!m9 3&[zS#pk`ƀI7z_Bw2J88:ĥNKN6x :J 8B\+'Ǎ+>p !;շcϝo~<ԅ■PRpG<k'(/- F9.5;+\<-͠+t7 |cF:yk'>q:N&Fbۊ QP*KxIQ^R3s9 qA:<}t($'8gkM0As7܅md)!E$ IEZ F y󥇥_)??s|Ӑ!$% lyǷ%A+֐FZ?uQu!ovJl)Nw~<}vu 1e[ve@]Qi4yRI Z_2dzH*7x>ڐ6$?~z>py?Md9,eJ8 ڭBN 0sǷuBv)e3v=Iqid7+JN))$Ʒ2,p AA9$5e|}<7rAƅrkp}ps%8JlMm1rW1VchjH9J1!2'<#~Ѥ$}_mcJH8JB}$>F2λ1N lP>|cZZ sx'\Ș8VAIR x!ԥH[K 'x tMEK)ѹC #βڬpAcG85.ƈ%-*uD){p`>TzRa'<μDSmNR  dI,; 'A焩[rGg?NTS1΍AFZ*{yiHIWaOgtkͳsNuqR@?#< Ż.:6$asqNIsZWNX,:;p0Ow3?3`[=E oӫb'ƗJc'^cԢWR>y֖B@dqF?&|JVOݵvRr7}I?]GThùi*)B|g}{28d-R aҖ2A88s{>!#ո#3~K0ChU(C#<[a2\qա/-2vݜV حƊ1c0X@B>Askdd>7-aM U6kvk~xH8]ԕ!1TsHᭌ:Rn sx< :З$&*VmeDx_<~Z4JA%AG~F*NHNh)##!G؟Hܥxkj^4a!(QCdpO'u=%KA q8#Ǒ}hnj#B(l(A϶FqMDihRNr5BI;NFSy -9תAZ$`BTAݳ< k%c<(4łxHN-,9VF$`}iai!zJR}@O?Ѯje{Hl(+;IAKpTu0 ǶuPD~O塦0cG:f<"fNFZ.(ҁϞ:km~ 5V8&)RU 瑁yPTQ'X@5ՙ]Rbɓhm[u7Q %(IQIB8t{ӣjhr| 2ŀG ;G=jNL-Tӌ_F-G#Nzk!8LXM6B<;A G:nT[S^Q2QT:R0#''ϝ(tzbV[{fCz)j\bIdys89:lu6%YڭR+Sn,<LaD{AFZ7~rK d8Dg'.!T0A-*RnJm0ü9qSq3t6,}E}ڽ@4J5lU$RۚeVԩ3Y8T`Tr`yՔeNffV@})_=8>yԈG BPRw3DeG (FRԱ.UjdK J4)uVNprs|xlR= Yeɀ!AJ#' ̶ےcsAj9[]-je_/5ԄG.(IHt֨>}.VZ\ϟ51mZ=k\PT*r*+K-@'sm %@ݻtb#7 v,aH@VUkkɉpq feԂyitxV9Ţy*%qc>,ޗ٩7ZҐnJK#|g>I=Oy#Et=$q{q6I_ul0v@mR1rI?Ч"uBo7QaI䔡<x1D4/̉*i/Wmxǿu,\[fC-pNbzYf2H +w<'R`kuT@Ld7=̤`~-J㑁ƶH+)(7JOaHak I`2uDT2*[!LZ % U P]2sev[>A&C~JByNxǝ/bWS"ӊB̉fl"qG$m92Buq"ö}Yu6*C4%q uTe·$SXE [~|mNK2ZԤ, qNI }|qT;MX bK_'|!JRӑ:MB qR[) VIRT1 :U\BZMC$Ki6 >Q#uq5e5%)`Y OA9#߃^"İ#q _r!jBN2\qƣ}ƳC&cvim-%0WqI M=iSގ@.wY 9Hϒ~[z *-K\ J).Hʇ?5!0Ni% %HH_@yƱa*4Dfq3RST8 2<|jtVAtY"5 \DV(R} IgPDlDq"Iu.6rlE-+IW8'|߷ەrKEAOKKJ!F4 A,mH$@VV`%]U6u"U6L(`l}ԕSK˵]CI6s?ZsQ7زj!q>R?a%Rخ^6tՍ¬PϘ5]IӅPNyԥӻ2׮[}:ܸ]6Ӏ!cJO6$I#WfH* b£Iv%Tq<=H-ҞSUD96_89' >vLcZCbҪUdȧBQ h j #䁏:2Hjlʤ-mIJRx>jC}t=W3"r2ʝڜNy'h* d%v(н[6VKb;5d'uge% JV3˖jQJkV[YqgiKM+bw $)@ϝ|R&Q TMkЪL|FDq [m'ԑˆRfg`}DƦ:-2JV+h Q ڟ9^ y3q)PqJqdJm]2szi8THGtݡV1ihqܖilVGю11RĦZef(N+.mQ>x.{*Wlgnp5>D ZytD\ZʻeƂB1:itٝ!J 6ɨ썈SVqXQ w/[(b\Jc]=% \h/EVp;O#4RlffC+=k4G)t̛tJ b.5)m)o$GnqgΩ=.^ b^e(:BP},ڜk[]&Df!n{|UumvVjye} Ttsƺgb&?2R,dZ j&y-q‚@$}M=(Is V=?@|7-%ؽ)CTjLTbʓ5Ryr1:ӨGakuI?{iquPv@% X9JUMt6tJ!9JR?gsX iqJdc='´([qJeŝ)%*] ?i 9_NjEb4gK[n[-Is#ϱug3WmU$ӟc"3DvU1w_c JÏ{8Y$I>FiPy  Cz#dwϣ(H>qyӾ_ExiK=[K BpJByK`y.VCeuʂ#e }H ':p79ηWnBRTҐ=  묔,ILl'>ڙ)c\TcuNyg xljPCPW#6iH{jWfTwJ^DL?L)-O=ZEF-Vi yA?rGMS*QԞMKTPP+׍=.$ $  RO*]TΣ?YLVnڥHȤ6i{|c_N*,8>NCC<##I!ܔFT57TVړxRӃ,MՒiW-$;P)@s='_ b%]«r{ }OU^RP/R)|aNi#}?⒖b-j*nAi`8j~/WG.C5 |5,W"_)N #u#~ΔR\:ͳsP dycuyzҾҢTPKlR7Nq4Ql@fzw|K8NJn's< XۯԊxT!zrG8U--ΣHvG! ;ؗ-QWlǖ%(c e#u$W-zs5?!acv8¶3tcԓVSGpQ*KnBSJ!?v=TΒ+6]rhW ᗪKJq<)ّ8Kf!ޝ:%!C$EnCZwOn(TE,)S}ġd:YY&åED{!@M!RU6P+m/6#)%8sݤ곫"T(JۑIڞUN4:jKLO88*v4JVkPJ琦#jx]]TsG2pD_Z3#`%Q:z-Khvc5+k2)U$B*)!9Q!;|{iJ]>fKWjܙ1&=p P3XzMc`JCR2*֪ yp&Lv\B~QRT? {IvO\b*Uֆe>R{s]^ Qtjrg7'MjFK~ JIiFF?5uJϠCpQjh#4-qPG݃O \>*VےC$M[[͌l j[Ѭp:Azm ܩZ5ևP`z4hѠF4h]zhb-JV;mc {~x [ΜvM¦WjiKeayڥ~H''{qNiӘbVP$O3M!œJbcާ^NT|륥W2Dw Ձ=ΣQjT ]R)!%lIN#c]9NkD鬆:5Tإs Zp.# `(0|VuMkReEX#Ӏ>!$ڵ#OQsPor ~}1]+?},u3KHe-KEIHs6=xiiJ(붷uRamM$u1 X*J@ܞ5[Ww#ժ3gTbGsbP#Inl$AD4d%+H`djۓ !~Wi͵FdUfT.jASJ'%*AΛK>m^-2}2 8ӌTI>S]O^1"ѡPmIλOFP8mB."k]9)ёVIP~ZweJ*Wu6 !628P'^L"jd֬R@#88=bb7Pդv%Bu(BJ);W][MW'g ?1":OmWQ[cSVt+%6JBޤYԹhM2 REvJ_-$y2@ n`]nEYQک(p(mԬVj6gtr +_+!-,q֐ Mv߫Sc9_kJU@sR6w88'QeAmˬjBHf)xܢ ʓ#zd)Ə xe^%H'RV'fù9 >F܉!3Aç);r#GJn6h8yʧs*Ϭ#r`+<2u2wPzBn}gLr܄"7TRӁ<OpΩFKn ny \@} `7*J|$*0ͦū͍UC5M +%'vT| oU35Eǖ) .:`Tgx8s,5XD~$0r)é|ANRSg@}p]27>\U?*|! ҥ6P wiWPܯQ㼯q2zTIǁ0XqSP*ؔ0 \u +РBIηEV⼖N|?CU[+?*=ekJS 88BK1NO+T :J+/ }+i*9Y %i5+~\ۂ/$3gd x=)HUOĥʩTum,д{$}Ƥz Z*S\Uk V>ƢF{͈"⽥亇^ rR8թZ(Rؐ)(=`+Tf"]b0kHˉs믩+҅r "kJ'psuG|&XVRGEFרUyq lm(IPJUV :e6 -4 U9j|9;'t4XqpK#TEHL:<@*8Ijy:eYaҖ?>Zzp$E٪I| R[NBFV Dp|W2ۣC1;%*wp9x$F4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4hѣ@4i۩;]paNͺ#(YXMe\M_VעQ__S_k?(|3kt#!k||_< o_=Zҥ?O 0Ӕճw-dFs4ܺ3@fL 5BЕ/ @gR .'QraeIJD4<)9Ϸ:J(4ʵ:\Wc˟vzwmÄIy׼N}GV V©Ĩ9bm)Zm;Q 8V`usۊzaRS@(3TY1R2=EJdGݱ#*ҩxmKd (' !9>#*#G.ٔޛU+J38w@R8:i=6E*ԪvR6*5 QZm*I!$=g>5=?*ZANN[A)#N-#p*oW_}U&5zQPvV": Q j0q@rTT]F%CI])uH nQJ]l*%ͩ.սN\j9Svi+YSe B|$ R[]Jf3&4 R ЦT-Nύcju[ Eϲ\DJ[BN0yOLZU=QSRRjrI}yΤY6TFrњ_伖$D,)#ԄtOH&ӹ2یR☥3!G)Pǝ2idk=ء/Z^Ԉ'۔79 Hvy$ P 54O-EP[n0H%.8`% '%eܑ=eʗtTވTZY0; $ Gn.8r::RFI!m$rA尅\̃[+q%!99);qsu2Vkܔx'! CTTBu^%T 7H/32&5{-~7))ڔ'\\+֧zm{6}5T(M=:S"QBKR'pNgS#㛩]7ŽQ6z84eC3!)SYC9'ƭA:UkAWwzS$8CdKqp7<ƞ4>f ^L}!![J[dFvH3:{XCP.P%9mϒ1UJV+~uBBYeCkm*'N7'8;IZjC WUe/vQ՞9Η -S%HB](q)O$'>}ujWuW\h"ZIRPa׶5 iP0rs([Z۫s:ˑ&K6 9R@s:_z[}&cPűK)ݴa> 4\f&GVr@ x붱L殢RmL8OS^ՠRNy2dD@C_tPm"T첵e+[   pqMUYκZK!$pKc >M-} ^M(2\b#;O}2|Jˊʹ9>Ntʿym:Lݕ"!-ıQPr@% FjAEH*[[h۱Sh'(9A*]]&lh[PbC/,)gGVLUf4 T78CԠ?Ԝc[Ui2˘g Snie{(V1sLؼ*ʥjlJ\IPXS$'8_w%D:&LS'ےܹoCUZr9<p$.(`9 DÁ+iN ?CUmbƍ-&6ۙK. nRh `sidC.8V){P^p2qӵ'(Skm(ǒ@:~cPB .{ ~"ϼV-P9'#J/%KJ}[A8#9}0!8U H39<9fRYx(@!>t~ЄG)ozUi'y띺Dl/!Ÿ :PP;88'44̼T·#?$iqa**^rpI9~i( ' I?M5ޒm($<sN:,iK!] >ߟFt<܌q[GoNsN>yws11$CITrD0ԒAJ*Q(-^,zì!0n?yO.F>\E+N ߡyɬxi5#ݹl8 Xm{IMDRK9-JYpnd0uM:L)| $c؜λ3c%q0Ҁ*h <'8ʐW;7)) 9>T'HR֋w9mQcۮTK!=$Ƥ~Gc%I!Ghܓݯi_.!Y51Xiԩ?Qf##sͤyq0f*[h+x d[WO9%M)hm72#Niŧ.IAY@?#mq$^JQ#GϷ.ЖR;=v[,$s8H;.^S;yf|Ž}KJi0#{ǹ<^@%-!)s}|iVD {k힭$FGG[nׁ#m]{+Q8܋6(%)lзӝGkTZJݐ}fCx%)KP?L= \Z<{[Y崶!aiF8?Щ嶇e A8<5_u ?wozO ,Yd}VS‘*׋%!@>}It -u!/--Nᜃ}6[9WdN[BS _u%(`,q:rΑ"2 $"1( agz-n x'܃l GXD[0{Olc韨:Vp wc Ha/QRZdOxdj,V}eC?No,RK Ir|i*MIQOޭDudNy4 ѐQlx oK}~OmC _PJqcOݦjQ iwd>G>?iJT#=t³SAR|=~vTˊ i mhyDSvm*Vι]kc ?Ƶ?R^ ( dc: w%='ED"_`EЊʚ,GJ$8Zۦ#>2}&K1C=QCʉ'@?<>Pm#j18iE*b;>#vBqϟxKͲzǃP)>x$8lBf:qiM<@H9${{]I-+l2 ZU )&C5/''T|p~Լg\rqе8a '鮂AO#9Fv䌜[e%讨6 h݁ϝkq 8\KlI$(syκފ$9w8@q}5!<˙! I$(p#P31A wy5HG[NWF ~*0YZY$)#8<{i`bVB9#:h6TPg<3*DbRN[eCo}/:^ת3|q#ݻ(+rZTt=^.q3e@l >>q9s AЍ%ĩh%*P9{}?]hI)C鎇`6Ƕ?QʒlOБ<` ֵ+;r yƳZAqu|Gejc-v Q+uiۻJad`Kca`|^܇_lڥzH??)(eP-?YRIRI*<a$Our<5kR=d}I .tu:;;Мy9Ci/F_ϩ6@qtdJIJVX(یgA?e-VVJ@ qsuXڠ  qrxV >5O;@Gb0~gIXy%l+C'q{Xݟ:jLK!V{9ZGdS Z;.@|`%Œ>LgSpZp1u)R6H)fR*bԔq~%jRRR$s ZKN$ϸ-l ܭԇJrq89<9#yK ";)P!*>pA!:ǟPf#kLov%I;F40;[-F8Ipz@ 'k)/7 dPJ^y)gddyƖ)r,2KHJ'M z 7*jMk~߃i$$lԶ*yuk +i'G:v*٪;QMaaoFH*??m"Kh51uۀ'0'O;Z ."UTŘ(T~6nJ"]KV)4N6g]y c{t ̻((YDHJGOZ ˮ)Rx;~NY@3J٠R8FLT) $iB P3T!k\]61 *QᬨƤ˷"\RGFyGNo,|Sio 7 mR>WsFMi˓\QCJcaDYJLS'l ($g>,*c;ڨRZ][; #146T>`$[;%KRS `=͐y9LjEjLF>wU_LMx |%@Kmxد8ӒlQ9HRTq>yv2ىQq}ť `J>9ƝN[$AP*Wil)Cߌh}?ݱhVO\[2>)]hKm ,q89?M,ѥY H#>҄*Hj !⬸89瑍8w\ZD涹:D KjN $ǃ;S9} + W\rjȎ]$nm2p 8iXZOx<US:.ԇόh2Kj)$!)iOixDTXK/nrpTA@.:=R-RY-'b$i;Wp% U˂%=Tj”4R1pٰGFHTzP$: v r1kP@f2]P@ܐ@'r46ȏXؗdѮWa.HymE<9@AHQ$t.Zbv˨IZITVՀ-W }4ժ9cRJ^a4TAE+ $c,3>^nX ȝ%NTtG 7G˺RTR)I9]v݁.ErU\[n.3ێօ%-'wo88ҷL-:gXw znLLJ[qa K! BNHtuRQXch2C( 8Pո#hN]ptܒprjKhLpAk$j r9WU^MwBkOyuWz/f-K֩۳DLKA6t<$+NUG=%֎FTJҩ5SCkX(p'7wd`aO:5m=T༧fɦUj-vcB d()E-!e'qHTގ؝gkh`9k\$oJIRޅq#7ru=dmj2RnXpGێ}xrᶑN)b;bNb8 3k]JUJզ-Kd F3ϝg]zKFDMr \0 TRI>5^ZQ-?E>uO= )=$UZvf. +E mP?n\Vݘ*.v;ЕQRVx<[6/d*C0L;KlX'<u4l~ڽ2Kۛ!&Le=ϥ #Ԛi64jU2*jf̈RionN`9ˋIKjW98?7RNrTevS}>Wm n +C5U KukBJxEp~n+*HN| 9Yng:Ԛ _Q'i&ϤZc|7%ҹl O dQ {L˭5L:jV8O+!H G҅:ө[&u)"!(  9B>GꌚVu$,/WݹhPR2j- yOstbHԍJ#iI'iuun-kP}hiuGqХl$!J JSI;HnX}:UnnjHBJ! ^Fw:nA}p1MtK3my&Q1)܆jO(mf`(FqBُ 0STi]xA]Sݵ?(ߣi#VN{&EGeĕKZUrp'%>Eo) Ǚ5ń A0FAN($ǧά,}*ҨRTS 6M:{tvבGQ ApySSRW`m_zBF?R^[cI@5Rtf@zCM-ZsMj&q5%Dm skJTx%d`憇ӛZRwdvnM fG|+N.ӛU %8-Dr\ioJ6/nv!YZ`H:uD~HTqJ_ml)l۵)x'M-^Lp?S!F.5`Bzy >I5J9g咬RRz¼q4?[oF2S+)W:jd*J'6s݁:T+0DuRjB‡1@2L]qJ%D7." x))I(F9HR~LSr\v5ˀԐAABMXoΧj,G[I;,)de c;Hu^{-/-#$zRT$`_V}]c+%ɨ\d{q<}G[AjkKN0H*9=ΚC(r:#*/SjEД#n2BRߟ >8v 8n#HM3*I`fHHOiOS/fD? Iek yҡn5n 㥸:kY9V]4i^=^ rRR9JU) Gd{\GrIW {xJԅ-fT2w6265 /Te,?uVXs0C!iaPTI~TzzJS +RRgmBU%ڒ%.sIQ5K5. # zR>5nKn;]n'?ptTޟ>lYTC[>W 'yJTx& [?,ʃ8ʀ +K@UO6T$k榢Hcemq+JaA R}s$.>דK}L%;I98gLǧKKrDFncߞxQF>$kY;OKO6,{d[[A%#j[Pۏ}4#cny}:i 5" >΋RI#7%ÐFN1POb[O*v/%C܏35=2{>S˃R}8NmcД?PReaVh6 `,~mJ 8;OҾTSwO K,T6XuB LTˎ[# 1?h.ET&KGaNJ0OJ%W+>8v1p8'zxvaDs{EB2s-tcҤʯ) EmCPm/x*ƚuLbԖ 5uY @cǞs%W'صJ}*)# ).Iʏ9W܄3US(SO!;U2s'KjmgjhJfO[)]c6 2$!ơ6쭬gj=8p5aE6TG>#@$sztVs*ΪB ܗH ~>mT4ӥNSҗW![BGs [jk I>(j^n+wd--֤G2Vy(aYqξx'E:͝]xndB\A)Q!$<(uF:1qWN6+_8p;7$ I]NN*٠Ԛ@fP;Vwi) (1gSUbȥe.8Ϳkϔ)x䌜:)b=/)JiYKIi)?wAYƗِfK5/q@-JA>N1FFz"Ia:ud4RMc]˒e ֌NԤ`!RRppǵTzD5V*C-H[FVARn:l.r$[ ݏid,^늾u9+Q0U1Kʄ*_O}3AGIxת UejE)̶^$vTڢ <҅BCzLuq (m2$!.$ yӢiLSgժlAbicaX"ChA !}ϒyWlǕt\GA:GvBN rӍ>D%u\j ʛoz3`8 h##\]6nDvv)q[2VI8O;s16z}:צ$Hy3JlykҶy>Í'2#FU"丩2w )Ibw\$ƛv=jeQndG$"JVsnvO}}z;KrjZHMRRdR2]bl)wT`=_P?f{HkD5$t[5 5R<S& %lRKG2 |ct N0 _5;ܴo4U^[aAo_89)i7Rڰ~i,zuףFy`F4h: 4hѣFF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4hѠF4 umԿLPKQ[K_,W\M_.&N+_k?(|3kukz'-Nd< oZ?XkˆRd3$p '$ vGiu]RVW>|~W2$K“% y`NZFnYvDH.vqKwomGw;\klr[|V#ASjORieB9Ɯ]Q2HM-)et:ښӄxyιsj\DRPCi)E {tTq&TjTQdF 8X>NR*:@)i$fxS?+"u 6PTf9%!YQj7XtF7+꒩mM7s>N7s0ޙP5IR|y'(pผ9ǝQR3÷E~:qZ""u"#ɠRrRe(i .I xg"߃>n5jGfSU)pӌĭH%pU\#V Ji&յjԊlV0zaKQINAY bvdiuCn:Ca03o ήǯmyNzz] ݄@$~dM6.[ Bp|⥔;X^Oƕ!ؑƤ4$[ ܉w~պڔQGҨ(TJn\.~ShDHTeϙ!jV0@ KԤMXl[ ="&VI.Zٕ@Yv_Mٲ_",nvT :=>y6(p')Y.\[\YTˉ1$J#!% %؎ZwܣIEI{k*3PO,)yýIV*3p[nË 1j@H $ '8-IrcEnTW?.q@RROאzaCfE\!n6ī遐N 1] 2KX 5J^Tr}XRS8.T%UL1eEF_8iP릿[PWPbZCP S uT@}WS\Gһ€!3T cIк^D }j͛[:s\fqG˝TSkUuiRihQPIyOdy)l|Q*7 l4,u k&RZ 9xHFJj:%޹Llh PHp}&g̐mXn u!'ҕ8њK$RF|̒9L0T6!?p|*T}Bzͳ%̠Aڼm6d||Q{ c0sP&TG %a)+Ԕ^7rA#\b{{FW9_8q㑡+gS[b=Ӊg̒*̼.Qdmm^[pU~4'T 88H8p1҈C8JFM}fnB77!D' 8 wVlScMDd,'tM"CgrJ׸:Xz ''R_.i(qҕZW$lcXP)La7<[*y9ciFԂGy\Q%)Owtc|n)ʊ[mAxV?5!Z}1$}`gmߨ)RFF<p6}ؔia! 9oX!v%IŶ$p)ѳ#?:ӱ˒cbaU?AuVvGGbNUk6e9Xqǃ/>RFn2k@HV@I(9'~nShC~K- )Vq䁜灧JaDck#'pLe4PS|j;XeêyeԨrp1Ϥ~v(l9 < `}Pjs?ӧ ijҕn):0yItoS|$$gҡqOiG'>QFJK)#G?8I.ItxNS<hƂ\GmIN}!X}[ !EMU$=h%i;88-ĶwR|Gl^LЖzn!%2rSҤcmI+KDsOϏq\Kx! [㶡 㓌xǝi iR66vI%,^WaCP~5C>ؗp'>%?όhRC!gqJd~-v܈0C0I'}ٯ0Xr< --YChl Nr>vTU9ҙFg$N k%Vp)VFOȞreM5))tc\ &[6 V[}?_:ZK*S>C92 m)>F뻲CC%E;KG = e>PrVF~~nA.)-¬Ї~xJ!1qRJTQ9y rJ-) )Iw99H}\l-;BkzJV<9I$1_K; kym'4(Ò[=ֈؽ }ut6>)$(ϏPO;+=g izJUPH>ruڗ˭F@P:2p(KdG␈W;Մaޟcʱ5Tyʃ kh':uɟaAA=MC$wPX(0h![RFF:( 'IF2wps 6v66 ƙLE {%e~̏o3j[fCktO'GK×&S"sqm=w2%d UyG~D)!EV~cGҟJ9q H )N2v-K ,~l0ꐀJQ9\-P㨂KǏOJ#? +<Yg9<ΑLwV#G2V0?)RP^G?:p(7d~!Ƶ!)R$Zl%!RAH <1 -z[lJ<0ۤQp$ :RUdBv6( }+R_hGRu+ж7$(pNzioH !E\q!O+`qRiurHx9YA$X9- +N܍,*|CgAF3'ysx4idx>}#Z>^L_B.${o\5l\h4 l]d>TO)H>HͲVXB=Ŝ$s5N㓵G[6-(P#Ԟ&2+e3 ݔ%I#鮹5嶆t8sǟRU)R,Y @Exۮ40XGur}4>)FưK)BZ[(I)Hq;|1ksd|үn SJq kSnFv6kqmXQM.ofSUrʢ~@8惡%!َqNRŸ qUқJ_eHb'+F8G]܈H!I$oKWz N $x8r%"DwTv($s2C+9h< څqkrR>~aX'YSz#ڴ~'FC`p69կXќk'(J}k(\[įuy})3$`}]A>HRpxRm[ $hKKE >׎G;8 kQ5IVy: mR_AsҀH9mI34C0ӟa9p6]xQgADe d!#?#w  Bsߠ6`rH>u@ݔZޒf12Hlm?~cui6ӎQi;T@?Mv*}qԢ v)8''d @7x9 `)HNyʏҥ+p8G׫V%':Mn!~a(qw{P )BV2pqtT. i ~e{<\kN=GqX 9Hanml'xV8AC''qmjŠR7}1Ƴ<5KS:Tꖤ!3N=?ӯmSeOWpdXOǚJ6[ s ~usف-!r\q΂YJ1}1νZ w({{)Bc^e(]3g;$Af* JQ@'qQ۷r/mmIAJJg) Ttՠ3,&m_u]I?:sQ? T8gIϰ]"C&,U[Rr1U"1;oZq$qcEIC,SnZpAC#n}Gk6VdINrqiIHRNczYVU'VUyOFb 6T6Yy *S= ZTӪPDwDRڀ(J '03 dm0ʒKW;@Μy)׫Ը9S^q=m+ROe@p8'^T=I^)e%.98I'qJA $>oR)nШ5rr-z} [%HNq-Æh. \o%AA'N2:c&ۮV+"Ү9v' %L(e 8 P*!'$@ƸWUo ̈́+<ʔ~e#>mAR ) oGv^@rnu&ΉD*M"B)Y Ip4sq몣m6ȏK|*+H!iuch@\cfRыNbᷪPw*)!Io1GW%2jܹW0$Cjl8 )E$pN?ɫ~MnҠDy*yhxeFqd~S{73f%΄wKs6giH!)9R~lB2fݖRh˧SAfD}#RۯPs յF>ݴeF֊L5sRR@RT89:yK~ԲlԬ;ЦMf.*LFp Rƣ;˺kD(WeE˯):WԌ3q7tI3ګU_A. TZ: P $`dޠ¥T^ݧeE(zz$c+xʪI94ٲk+|lR6e %$ :yd i554}%t:I6 VBJΑ:Қ{}jեo}h%uiHKQ,T~ՙL ̳6TgDg[P-l V̏۶Sպ}- 3! e[TV O]uOn^p]NMVZn*T:ZuS76M,ws5%2*RCRf|+ ** (8I#Κ/PeeB[҈G9 >Q8 󣳋M6 :]_U~f7YiLzm 㮭eE QJF4ЙЛJ.5iiyΪSͥCQRSF辶!m&Lk:"I0K[$I^P<6DmR"ݑDD=קM~QHG%$xj^&V9L7hJ 9##;xOEb ]o_iTB6{$<Βe1i:i760֪\ ?valBs']]R|?RC[|%( Xo$nJpG SikrT.ޮҧS;^yH}*Hmm>s@PI >BޟW[RdZi)!+yD{$>"hUl J*_ʲA~ 28p|-P*/Ca[۪.b!IB:(J-Qr vT WVkpHtSNpx܂y#Κt U7_O)XoÞ _/v xΕq<~=@$P-da= Z&I9h.2B6(%;xX<5Mm\i&ϗcVT}U&b+pnOm %YVB۩<~ŁB˨6KFmݍ3&҂Z;{^ B}X<5zngE/UX*"l|I YXCp03>5}]Ku0Nh--iE#qKy(mΗy12UI-y!pqsS>pv^RT6`ͻWYUn3rZSSQ9ejP IȯYzN֔P2,.6 99*dβUWbyZe6zkTVG ORry*^o$kǪت.=EKJJ?~ʒ5~:= Ekw䥦ÍE@zw75 MnۯK&U@M-ʽ!+J1Q\DDR_u㇒VI9ΠGj[I6϶!8YNG9۝9K[uL@KJL:d-pnⅤMuNBUYd%O/jP -`J2~qu"ͫ\6uɷFmWˌ< cA$!z|!K 8>W3qӒ1G(/4Vs9Տ֙:&>',>0}f}meyDGS̸_S%#$&6~ ӡpR+7|BL'ͿS-5p I<V ݿ!!lrI)>8'M[~oNݧ. Nܻ1+奸PNڣR}9,R}!rˍeƗ 8u'T*T-;r>lT iH'qy9k:tԺ*IJV;mb+v# eRg%<:t޺ǶaMMg!֌JCmu Br9w:W+S*ȰgԨa™J Q +( 8ZH)iM}4>ƝzWЯJ\Ps%'cBT6ܴfS[%|(ٱ pV}q\)(+MjdcV[KmZV|x<<ƹV*u:>4/SRZP|uΤ{w"Bw+jp8MIM>.dVuGYk>9)ﳦ<&Py#8IlrN-+m YT8w ^\&ma%-H7㓫5ΓWkX^du!ߋWq@d5֥Hl(tt~:]2%XJ 0DoJ à ˆRyRrCHJ dU$2@A+jxNxpwTH}H?Q=p=0[K~2ٮV$[4ٯMBvzC8?w\kOW[b7 cȎCeHiJB\-OSv]v F Rؐ IBPm+PJ@iOe `s}\k;:8HH|HPE>]QOU=]݅ BS?[jt96p34l_g ^@u`gRBi٦ڒR NxjpĒҦtU0c8mwqεF]mk\L})ۡ7$؇ Sy1=6ٓukT*145W6."fAm`’ j2\o'o(iv *M÷gTkVkդ hRj`uPc5uImnt!YÍ,: J }w>عmRƷm$*rn! dΊ#}]ʄڼ( IG}$q3{kcvD[Ƈ.jCn gBRĕiq'SBߞ9Oyub*۠libCp-B$ЬN4z7wKw7j%.w 5 /ɭ@+JOmIA`I]eu$]bLDp'nHʊIY2omZfJ&F- wF} 2W~vX2LYm莥  |{ib:eZn6brvIAQ~=䚼ZK(skH08+5-M*SSK%V]Yzp8ΖOJ_P)+5+nWR,0 wc8[V"Fx-JbVs8 ϫu#Rz .q04i72eŨ4nVUF#w/N.;՝4D8pW,Vk\+#PRPK-*yP77rKLT)Wh!M<-0~#jAmaORcZR ryQP¸N*]- :IRqYG-U&݉:]sխےoML –C^$Ol+ gUөoTZuQBeB)r2 % PjJ= :5\ͯQ){LJE1VpRD${ptU- ƭӟNæ6cHn8L\h|t) {ۡ;B@ܢp<Ւ~$mX@6K[mI#2*P Ŗ mITT(}9g_,W{踠*V⩐ w+cSFp:ACb;k`0l22B@8X.PԛNu)ERL@i2^I]ahH%yK|+im~& TlJZBHVR=`qE)=Nqwf:ldrA’F}ƙ7'F![6ۭ7s(*CnaD%I*cɶme5 ZĔTM6drxC5xQd[ӗQjZH[j*#i8ǍJJiy8:bYz-Js{~H#sosa )jV$`A㑥e?n6*TP^0318}K+<:\[B'!%⌭HQƠ[}}Nj] eS8HlP$09՘(ZIRp'ѫcH6pGk.niO}/7섂UI2izy>X*qyԠRNNOuZc[J"\eeJ7U=sRejyoGN6 Cӕ8jŹ%2M]MRi]u7`ϙ߈pJԠ(<sFzn|JPJbϑEE nT%`N;O:\q]K/PœyŹ# 6(ƣh5S1\ע $NܫkdP#u-n*PԙT])/GPRp`crRqg`VrWC~zVY(jP4Dpd*| 3\xr),(gƑѪ0RiыڒFAK ΝGč:P:|R樒-zr|-t6$( ::LZ1mSjT!NHa/!T8) ẖ$r9\xҧEu$Pp'!^M~\odc!]Ƌsj#!`r4[2+j*u-0c†QUi2b8` `|Tk~=6R L:jqS$&' e>ښnWO=B8Gq#ttf-FVՎT^ENSmPwby`=HP>:U[zjuZcة1${$~G_[oZbuW x0/PԒ31" JN堜g_2! Kw v/VM+gݎO9?יjҤ׸yFP 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4hѣF 4h+)?RwO]2Cu/Gum/G|P_s5~XM8Dأ]ů|okO:_'5/r? hWGaGձMi56 a B+bu`1{h) Nԫ;π|.6>NJNy;kiAI9i wM ]-&<یX%)*03V`k7x>\tnUbj˩Md(7U}45nT+ɊjOPN>mO8@K@ ~5gw"rPiڥ:I=(@HIowH۝Y߉[LK!VRa'3&b#JʚSnPY ʊi![}jj ሰ^oi6+j;0Ȭ"*Bfe,+x>lU,[.3Ԣ_Jv6rB~nYۣ4 ,dA~RV20*RpI4&LШ"Uy?/+g -ALnVF!9{1~8(ӜeAUUsT< vٱT9(9DZΤ[K>؜GF)ڥ() n#BUViJ]=Xoc-gNv4wmoHdiߣL1C$He"+Kit?1R6"6:L҄)NrGl`Ater*BfsL\:җ@skJX[eѠijujj.^Ӟv-$Bv,eE]AJvF )hF!+\ Q}R.C(+y; IX>O;)鲛e=RSe<6ߞu}Uz5wBv8:8TGTci}f̺EzRn^\v;)8;ђT9|crM$mKHjHQqCyҝ}STƒʷ:u9$ c*䣱؇OECDʃ%ǛRAR7gPtoǒ ZtW'qu&VX\]$Đ9-6]ns[yݔ┢6%6{t!sP<t[S_0\S~׏8dYχXM١M)6LAvZ)OvO:ՠzSKp:m!%[7dx:[n6A x8'ר9laьsҜ2RB)>~Ӥ5.%ԲR>mNV wb1GϾ?3#K1jZ1^q]_89I\ҥ>68хpc>ti@X#jN _omujR[ޤ]Z7@ gǜ~ᬗ%m<8IPG>JM*R Tz]Q*>Č e8smdK@>c8_y 8k *'`=lj _Qڤ 3'8V~] 8Rd }2yҏaN0PSC9|Z6QI TT?kSͰrQऌ~ʏ9\)&]JC _N)탮zQPj:%*ZHX98Ox>~|iAR*Zf Y|  a860ϺI~[ܦ--K Hh'kLзX1!'(#ws"[]%֊aϿ c=a .K~c#tT#C`89p3w5h.PB;V>~O둩; 4ì[i HRH΀˜$8S!.~~vo%Gr=@{~|k/>ĆK%уH]q++[G@>kT<4WifIہGq JGs:'ͽ1BPtcʂ1~^;o! c4ֆ!!ImUn[FR+ IIP\j+J[aCql3 ύlm,vN'r~]tL}nێ+qիp `#\A20ԕ)!{A y,h$尀Vd 8 W魒e!)VdZŒqeHq >| 8YyN!mh*@nq>Y?)YD@_qX^=\9>묡V,ZTY*;cMj\[h\IZrHg$LhZ]zCimN0R`8t,ĒCIvߟJ0u(›pB}@w$zҐBT9>#θF"pJOGiEHuOΓB/s)M)YK# mLFÈ#1ҷv0$+؜x:ʍ6Pu&;l%xJFO]3V5!j+i+IsW5E.7m~>4m2 vqu%씭ETF@ZO%#1Fũ*8ϝ$ԙN >RPҢnuˁ3eaTۃ*A#8Ɩ$SJ^Z \ oҥ{`iSYBaM{ (n'sRANzZGml֐ Z;s?MuW=ԕʁFWoP^:k$p^ g>|5tN1*tI# $ 4aN,RH?ui1660tpA',3 )Pӭ@@yCSRdr̕0Ty^[qR+oy(_dgQ=jy qW1(oV d6=>y8uAmu亶]s- =Bv/Gh} Rځ%^p2 d lǎ [hRBМ*hێ֬m'O3[R^惋8RG)R+NO3[ǘ[O*HIH8n( Rp=w!R0cvR P9o |8oGYH pǸ7JiqXRBQWВI8϶u5s!nP㌜x%Pe%*WN|r1=7%XNB~ď!(a;k%K )om$IR^i >=j2iۭ)[# T*H/VCy$@<.RԔ;q'ZRՖB]f;ah9Hul2=(RFqf!o>PۍpHkl˻GNiʺ#UiaOI[:)ۑ4.ǧ4o[mdih\fA l3uA8 *'JF) G{:{=xw< $JTqV 'hQ<N1iBUO$7-Ď 1.J;kR0RJW}9>) ژi)FD8ʛ>?]%Hraek^HI?OV [R>> $U)/mrR$$ #o>lBAQJ$Rd1[%+ZZR*O:fJqi?C:n&ME`%itc~]y?rzZ}P$rptoʝKt^tpi΅R $gԟӯ[yNY\TZr6c'b݃DPFґs\jmN(ǹߎ>X7"S )%זAܲ`u\c3l@n,*'<ÒeK!$ i4ZNmuz+3H u< Z''ֵp}Zl\O $x?M5-Xa_+)v0ԀJ' P% ЦiidJ=A\D5| Ѡʝ< Raג)''UVHWVm2xvzX$G~SBj򄶔(Pr$ãICvMV$E 6qۇ%[?iGkoYZJr>8՜ǧFlZvdg%p r$L{߆Mzjl4$aArF|cR L/G9 y. !C؍ux?=H>c-IgB<{Jde!I۳ }4T+Kr)o炅8AL,Ž,>/M M,PfB%v9dC\k˫> c@ڼPdDHGĸPZ6ςskLk !E~ #]@225ZRG~J ,oP=->6[)L-'m Q2y4ͩ[זtԬ8bS)Q`4ølFB*uО&L-(d 00qҦ9ӄ%C ڢ=Aתm=Y'>um{ReV=2݊[ 2CڒVHZJOon$ԓҭx>gTUu>TڔxsX)/Hy@:)QsƉw⸄(N\R|Fi6*#3Oɉ.Ie 6FqңT"2ܥ,+v'dt̋:a##>FuJqkh4 Omb[Yk2?G#\BqD!9wT8IO\k1%FP 6|3_Iϐ/KIS ,N{e_s؎IG'LgQ ?#Z^JrsqεB[`P$,q)u:y1¤n s9ֶjf7;2Tv)* J y?]HHVYvD[9<|K-IFuN-d=ƆJ|iA PJqr||}9+K|5Fϰӝ̇BZnA۔>ruO[’>[ZN'>01r>lrԙFJp$G9ћåĴ;|jT~5&٧@5@ܒ0OX7)[<u&3t*-Lw$3H,gT*蓪lYv3H|cG:iRL,>(@>HHJU5q*'1?u `hf 4@ H5uߩ>Q+nmb\Z{Jq㐢S3C֔rs}4+:7N u8w$6J* O  tDiJLXmN (2lq'os ([a*Ba~BVtÎ.vHRJ69)΅MoI:#=>ܿa-WeyUZ Y#8ƝOer$He2t2V;q3״7M)m*;jq 2 q\x|!Wuz£N縗BS8ƶ>sҗ %dVp0Ig;2A  Gۍe#EANf8BʂpG}uԦdc4d(pp?Mzw1ʰZ%qĮl7$3dipӨ2r6iSTVb*N Np2sޗN3 En3 \9N?IAG GLtJ)qkVxLDLN8ZǞ2]nGCTe#>N&.;ЮR/=S Iڃ16$w+X̴*ӒGU*TlJi [p:иN7C#! Μu{-tb$p4HQp3'i*knrTb˫q8 I)! c~bvdT^6mTK-'hO#D&O"Ժy Hg J= {>rurطOf8N9tAծ/.:QEYKaSܓyƟ=\S,J4Ɨt:~Љ P$ڽqΦtWR.#.ҷ<(~FHkFn˅ӓ_;(mA$e21"f7e6jCejlӽ];I>xG]TmUPDrJKe͝Q'?dqmŒO ]"R~e=؂ݞuX G*3-IJBI2:>:Hib^fF.Gy˄2H%C!as=>;FY֖wq?H?OWArEQHȻIIo*W~Zj%#wf$ Iv7)Rw$rTFIŽuۧa[RXys:e*Ϋm7D.ε4֬*AJCfJX=IHHq݊BT7e8YNJS3sY#&BSވnU&B <.B^G8la*H9WʇgFU g]31~lҒ(h t^Ru/N>:l@Nu ۪PJQZy66r #aYA~ ZE檳jW#2)h{ߨ~W~pfYP|Ma1b<46I.)NgZ_G]cj,[ꍴTӓ$P%pFAx#LXSͣkމzԚu_PZÏ (6v8nߊ$+Rl[IThq5RI@u+Bеp 2RxŋԩBE/ќn"jK@8&ewJ6`t<3h-‡6-⛂kwT%gO=;|TUqgShIeT9/CklR8yה+ۢŦU.K91cbԹJ2_ !Xi)jNFsBvJgfD-ΥЯu/Ue5FfӮMnڎ{im.-6AKsRn:=zBf,)oЙ%N o;Sǜu2esPdEf #R hN`!҂6c#V7+ȯNd14+ޭUeqPTR79#:sLHviOW)> 8 cԇn4zQ6ր9! 8#P~Mʬ9}&Ym݂@<6M]yp(-G{{"pv?Ό*TNٿuVQCpZ5O~%JԔ'vBJdgj*=ς6RojT P~4 ק`Zq{,*;ɊFPC%I*[NoIz6Ul;q%9S;[K*$o+))ڑǟqƯ&u,BPRyGT˝VFr}5ilQ/Zs);QuW n@vR( '9:]_'z -6ڻ gvG%?T0-* qV[JG˅ImDna^=Pfe Ep?-s^wSLMTnmh7@緶/E6M)IJKY)G(LnTEEi^!rRV9RqJ{<| f}Jk dL [*mJ g)ʕ2~No]4nãeKyJVN@mcSkU÷%rvmvDN=KRN7p4ӥcwQڲ=;$G93/-!dp5h]R`ViiuHe >eHnO'9?M>a "*3ͩ+1E= RyV-BQjN4-fTeY%I.PWK4%*(w#%#Uf Cpo ;A$6JIǁf[wjVΨ1!(H6R6 2MxI+mծOMM.~ FTUk.MrUW[{mTV[! @oI7Mm~Ƹ&v;e1--@ 9 9#=h5mu^IRHy-mHjR>8u6¢)n*e!kR2THyi#ש;6( d!Юvn}q|tn@U[,je"jRj.36KH*Py .$n6 N=_gdt MZ]:FVPD.6;{rJ:߲Vnu] 1 l B)>mM9dT#toVq1q5bۥox!C)ϨqϴqzNdȠ^uGR{Zr Z>wE)AcilayjJI'M۰(^KyAJCad>3|CF1̗6L;rJdK`aAu5{m2hNԦU4# Е+?'/ΰU>]%ȷ s\E59LGJJZq ::%m9LwD0P Ua[܂S6xIAbލsKoy`! >~~iXE *}@K?ɜJpx<&[fVˍ/gmo%E9Bp@J%j@L"+].!mQt\9T+]:6>VpR$?S -M}`v&A Gö鰫W,IZj59Wv?m  s#D+WTZ5NMJk !C JgR~gtյ]ȨĬ4ⷧBI*둩&M"(DR"9R w ;JĒyNo:VuFyT!ǔtUwZ=/ Hs :Pg&dqPO >9<5Uӭ[4+]J3xᤫ9 :-Ѫ x1>CR6q$V)$?=Y8(w$^c>V-t R-䤢8i<fcpy{C1>`;Y=zYyLˀc BSAG\ xu/iHt=_f; jaRJ8'v31KU>QXwGLxoiwXmZxڬs^Fm )&Vݣ~ZX}ZDf#O5''0B5Qn;@#Î^Q@$#9I# gJAۊыo Jɇ7*46ǟ}V+~yV,hCnZ:n+UD5S.X] Wg2HYv4̠xuNd5^ u7+-'cVӠΟ2u޳˭< Civм.j)m 4oӎT`ȤksvE_mN;&9ܐ[JAJ\7M% 61! P#jTA*Qgu͵@nt( (yR}y,.lH˝V pүdpsK2W젣zK |4MQq[ vuF^_N/C'DSNmG.+z)m@89>voVjp7_MB6xTA#)EڒIx\'N(t4y˅:6F\)(p}JNNbOӢ?NC`iaeXN'v, ͔H;5^R.ҷq-G9#QլRț\Ir7ʕIRr2T g|Ա:{ZW8o[us28Soy^pdjKKti2-!{Rm"&%L?FQ݀Iq[$%_vJt+b(sܨ[L}kJZim%#%\Ρ$̂Mm)lSZ0"A)BOl[[j.*XMowy;I)JBUǧZ쪻t,unE8p+j-Plx'Uܔs tNj%N)(nu*H%ge*AMSCAnl9xcqO>[l*3+ڊoRJ+%NKHqrqq^C)RxǾq}ҋr]wqU(U.[$u C8>'o:]8ywL&XK#/nG@ RwFxb~:ڼnRחߩHE^J7a*VkS*ԠA1KRNs7b.5!/Ӥԗ\xӪˢRT GR$ʖPߟc;k f@a@u1K丿RBJ9?hMTiJL٠ܔ˩p^\qx@`yպ܌M2V%z HvB(s҇s R *H gs=|R)!j,(uk!m?]MaI_3E"qQk9klu.G-3'7W-T-nR;{:0AVZZEJ ڒFAJ+),a)TmF)džԒ~>uKo TbUG%8G$)Y@GqK2!^iRJ\6.$s9#N>٦HQ+Ӗ6ӡL4mCߝΡ.^c:nԫɑ%#n m+;R i a@cCPbd- MCd/! AB1U,| gRtKMJW[Cb36mM%gƣZ6Ujm{эoy3iiIdh8('ii 5*LUiBw+I>pxP}ePHlh8{$,0S|uOr|2jKY,Fy`7q VToZU53ʣSnN:; %qŽV/5B[ `B_mw҂[Z@)>OӍNPbO!!AI3 AK l2VlI 9g]4QL v))ujR J-kB #:;}0gD]g BAl#'OvnDb%iC3°1L_]^bJV۝x7Fq[oea$1-)Up{(-ޠUHT&P*!Ժ !C u_UTڴ)q)Yq, sPM=:qGQM:n,S*gvBq¹$yUBRc?ORI%ZV Xu*T OmJ ' 8{t[h6X07N0s8E!tVnw(Oj>N7)\?mntMv Ө>E.Α$?>46Ⱥw$2d8ztzw4UĨ2*Q_RHJrSgj*WιQqK=)j +$;P>k`WEVb:Nl҅z$t=iTmC Sxy$ `񤹔L`B̄mB`+ aE `|>uoӣ}." B<}4LnYmg{ʖ!jVG2GUk^;&ȇgr*2i1ʄ:|)I#:uS+P&Te9oV jfүGq)Rr i}6M:u) QSD B#'=+) 2һunIYn"XrYa FJYm'BHΦނiI2 DS__`3s\:2D8y6ZIN{d''@="=VTdaDV͡KBFմ+>gO>\Z Td.I$5qvi*s9.<].MЙXBMq[hF@Rcj 5Z wt4V9֔q aĥX+#_B~#m]֫TP1=>Ψ.Y;ڐ!_P+;~Ѡ̹$_n 0Ppc~RH',*Zdۀ؆Z']N[w&Ё4VO:׶='Bk竏]:,s\IJUJᰏNOor zft몴V]5!FrsEW"[ʐ\_a{]B09JpOJqUb|(P+*[A| U\9ծ|VۦaKKgWZW%Dw1$yMàMVr?U-+i ozA’32xΤlr5VlZ5+n[iI-%TZ+M=P`8>\ ]Z+Fq׸# {e RpIMjkO{#Rе<qtF:N-ʛ#A8bpSd#JJsFG9R1e5!4R@uPE5sM3slw%F Ny}'RCA1Am <I8pnE[9++ZRȪDΕMv-[MgԠ080qv($lv*SBC[• .B^ A9_/U퇪?qJզLT jo^7Tuci޲}Hq+f}i})n 䁑Ɵ^u̩NT3BjJˣSW/Q>yw-=t OǻsUP;TP4jCF4hѠF4hѠFz<ݧF4FirE4VG{Pv߁?)b֬dU;~S*iG͍۳nvz^avφ| J?hNz᫙$[v*dG*Ut8G`:;+Iu={vR$Vd;5*e{N[o-߳>Fڜﻝn(J|A"JdǝNQP1*elڊަԵB+=<"ʺ_4=H[)JīƥJSJP.}.ۦ2|+Hz<u~iNҪTۖo-€!U@Li @KXt2T*T-tδ> P+{QP(2 BSdKm7a[̑5 AU"r4W -\+֕,%<C =Fxݯ*FQUUT}S ;۳ow{<·+r#;8VvX߾uVώ|>up-[W\k2OX0TfjLӛ@8En% c2 OfhWD>JQWW +{/?2{4GG뤴p_2@p$Si=I9ρ J)/SSUZ>w%e'J%n[@GR8T9-Zɭ@ tzM5B8xZ*a}^[$g]W3-R A1LDi)CȎ-HZ*FCF UF4hFeu:6_W\?Sn(H~.&Yk?W|okO:ֽObwS?K2WGa5v樮.X &Bt]-I89#ϏloBBMf,BpAY /o<U Ͼ)tm[QDSO=wWP*:$J%6)Ҕԩ,)x:cϩRI_;aY{VSÌQ(\pp7$%;A=XҵѮ۶pNNoE JùE( AV(t h>,phe%Bz\8 rr|?WUb}\:E%LLf!ʌ<ZrOʬk1sݭdĻ+`seq4jҞXCC<qtE1ULjf"gC(8 G7LlQbdc&-s;;w2V$P#:jU2]PJ/+\Ϸ$G9ֈj˘,;u~KmrۨE\)+n#KGlzrU+Χ^UF耦-Ϊ\~ Մc̔) -(JAFƧއViӻ>]:]Nr)SCŸmP*BJA픜cNtuxBĜ^L7* jBP8.RRTVr[KwZDdSjtT*)Ju4Ҳr#ƹjuЂKMB}>i>WۋJ>Q*6Z pddxL)F9QΚ|!U>$njY0S#><5'VOx}*mW>["R[[J>bJHNJTF H':Yle2 5)X-*e^HiOjĐ&JiqfD+}M^VT9|5eIJԘ]! /$a XKS:AOd\ Oϱ*,Ie'eY95RthoÀR|ȐZ5d6PIJJ ƶM D$>]4עb=JC )y8y3hPue\WGqlmp--3܇PQ#Ԑю121:)TgMW~yy{ I^28$s?n)CIB;{Ty08֚ٚ[Zu痵*BK]Pnks#3m<cImq|Vh$ﶨ(c ºN rrI#8pm_,*m[))F?'@ 2,})ڔ"RZCA^8ЅEy,;+w'i'%;I# iu-<V˸YH<)ˊqN%i@ _ӏ4d.  AIrB]B%(JU~z`mme))T Y-Pym;F6%I<+%9k[orQrrue| kF9` ujIBSѝ>s~@91A-t1xSm%^y r{m?Oc[_A[)t~#ưؔ8y;e\#֩uK9 $q%v[vJ89Hld=9c~ ֙Neh;Br\o1Ǿ|~2Hek.<]xXJPG W9?{Z6Sդ ;sxK è9$m(uevϸ>3]MI%N .wpSpL"ZV$=O ֖̄hQʽ H#}7 J#)J ,?\՗\e!a ;2?!RvZ Dp3|t8܉Kh h|IPv*q[4p>"ؠ% ($)?RuGo RZNf&B7k/IFy$ iTvؓq'JJX)e#vdkĴ$}$q㮕›mX%9iBeUqc8򾜯t~zSBiHl@ʰpwa^I?k[=źIP>*<8 {"K)^#`@$s:9XۋACIv?tKI*Skܯ[8Lqc( QxcІ8Ʒ5TT'OO1'e)Jv 892E.-Tئֲ#I5IIS:5.dOA5 ()!*;#ϱ<. Thi qkOl'}|k;6xrCHy 9 ?tRfaI-1y$3Mv&8CNIxK anqE 6@ t%h،N&%uҴ4␅}*O-lLJRs>ǏqkNV 8 1U5;)T λjlCCe[H9H84CbwҧZOe+>}j$.JP`:#9?Lh%>HjI\N}1j~!@um,:Z@ dx8#8ΕPFPp}J5M7B;\(9QPdZ<=vZB+^CGTΉcĔ!E8@>~<@P*dx?A/>6nI)$9-AYYR (ť/}߯dԕd *#ԑk2H#}EZA)y9MsCJRTW~~\iZT[ ;9:ǀWlRT^'FZlH'K*B!>kKHCBxkW|5>D_vC6J r1ΖN6n'5d$o ?eӰۥEXAmɨ~ML5xw;]/$m~mlfSId,#i.@~?~ͫCrC FtͅKeaI=7{Q)#{j2;$)Z") QQڊ:\a4p#ccuBū*dRAsDQ g c><FvhڟCߖ l*kߴaԩf2B-8I-"mӈQ IOss ZHr|8P3RnC;@I;/lyj2B@Z[B&5Ju5[!Ճn@%[O}Gκ-x0Ӧ5QJYJpW ਄+TLåzR|ƶRmמmAK~}vML6qzB q+*$'BTURK#jJVv@8almm@${Ҥ(!GGrtf{jQiVxX(Yr>co̲^q.x#M)J ҼUsm-QUaWƀS٘FFHHgclî3pKk@" {% gs'E !-ŀVqwd>tݙc&{:M=ٮ nVr@`4Bg~nOX ڑǍ8.;5ǟ+FOk"PMdnShZӳүPNI)ہNEv3QVZ('J?XSiZZ 3#)݃?ƕKtF% "ƤSZu'nH8@/WdQKrW)q n> ${yՒAqm?kɔ##q|q HơLz|8$kнoBJS|=kOCV'nKR%;U9}989:l*)ܸm ;(2<bY/)N H%8灧Ƃž[$(d]3ӶOipWm Tm٪ Oh$@uOIn~LUn UKZ8TAuPfi⴨zj0QWpr'~f@JH9riITnV9\OtEQ%6YNFT@r<9],;}zVnΧ7&*b;D$`8\6wjmD`cM)|ϳT|L-YN;kr`ekݶʗQӢ2nJGqHGڌX5gFVГM$A#%1sƦ]@hui*+`+/] `K$QYS)D CLj;ii9)ϐI3+3u^yL3$)u_*<5UJ٫ME.뤶۩ M,ghI_G Eziu~%Svӳq`#ZG)϶B\B\w[tb|cD^2iՒւp9F?,z\j:dH&%yV@>5XVB+uݪbGKdJ u_VmFS].l'E m(mi)G8Tr|ITjTZzmM%MZܥ'#'ۍT{*595y~SI8W`<~cդ l2d6 N>r0Xg8;x׬T^>c+I@jl9/q_# R ~^aSe6w𕂖g'd:WtKڔhвCq$>dNy6۟0㺖^JIת>b+>bBkVI gPA'㡦 s`$}1[7 īTJcCХr@J6Y`q a)+{`(:ʓսTrɶz65.ga'bgo8xKͪ/L*1鷬&d#*K항#;䌌5Q2)G)T;]9pr;hSO|r>**RjY"yRP-:ŏJ^R"d/HU+]#vLP7Ejܨ |G OؕE # [33*6V6A߭F`~KT#5*UHm֩A)D%V3\ 1uRB׆"Ci%1K d )8CP䛱K.6m\qĨ`$%) Μ #.<ԷJ#IZK'H/6e6oURZUu0_/![$lP'9|u'O^V4z4ԥ(2R<{ќg^iǨ( mǝsHDeҘA %8|pu+K7-~|YTSӨU$4jRH\F0u~ڨO:%h%]֤ FRiEvӆ%Gu)}RS{Ԁ-+ # >.fߕ> -p(uY:uq&RT&t_u/KI!/eJH'g(4Yb C2Pds%Ф!nJ()P8ӃCU帺M 7*OilAQ ,iSd@#El7T>J]Dϥʴ)rT?BlA sE-%*MN[];PNFhWjҕ&⻮zDV);qvV2BIܾH * x8Rwĕ^-rG!*sq(IQHi~Dcؗ ūpLyg%*;JdTAӪ訤,\ۂTu\Ez3(ԗIXWJ6VN1"O.MnTUj62c$ؒ)J E8$:h_]=ݑ^m+,_]NS m # q u'_*iW5 ]2hE)vVQ!< t bS&ꓢâB]vtURw%Ag'n_Po5jnj.0ib;՘c̐S>u9u* r;TnN 8>qƬ\+GGh52j tRbӠElkrQH298*IA ]jX,MWh)h$*-&#z{`&: XٟÃ7QJUoHr3˛*xdԜ,cnt%XY˖aRU+CZϩXK2pr8:t|{jޡV\W6JBj )Q؝ E~w ?'mmrRpPF}%BzclAzef4-Y@*AQ%AG' >8Bh=>"[.!͡YQ\VN?:3*EFdZ)I]F,*naia4y{T-e~X4zb56vR8­W%\XH&zPDnUbGck!2! i$$- `K6X4>rܟEaJs!aH?=Lu;RrYnKM6 ,ڤ}5?ĤuSRM•8]lI޾2S98m҅V[IJԤ%饸FeHNA?Jro:5LZ{N=a qTpH XNS˜f)HM̥dڋ$db4Y}\kQnZ֕PhҫS}Λ!%<[;d^0MY:1uX=Ħe.cD'VJ?]IV/[yƁ:֬DlF{n8e$dseԱzVﬦ@r!OS'm&2ڑ:Z ک7Bߔg qL7%qy{yTgKR"R_Xe.r$9NNnϮB7X 2UF_/``n;r<ԏAOjj*_ʕrB }``?8Z]k5IBn{jl\+J )^@q $ HkS~8^÷iMZ\p(nq;21Q &ֱVP(TEe@/^,ް7ѧ-{ШœPlI `@tt JuL=K*==XJzRR#1ƜoR'Q 4 U>u6m}Z!S])IpR3 2߆݈*MeѫM$(sH.{y [ UGìV[OT[)IQ#9 y4.޸(VBUIJYS? kԮu-AEsSMXqJqF0|c۩_Zu"VRiu[^ZVڀ8-@ROIӎʽUJFYPPn Q-pǀNF4 y̝kJ9|Ɓ1[Pڌ<#FQi^;JҎ;Tx[*|ժizrֈHmƚ9I,Rϒ@Ė-/jt̰h*P檟(i-֤;S!I} x:G]WtLkQ)G*v\>|XmJSB AOpVJ*%&d+qF P ҃\O$i.]Iځ"I:M93aw4 RIȗ)45n4@}.nOm>xZ|#v=6s-ߏ-8]Bsg 7p=8v9Rh{5g:Tx|u8P+#Rs;:?պgx}PžCkPo9xƗey2nW G%~u~=n;is)hz+18*RRs^}vQzJ*&ꌉ}RBVSie'*##R]HE2*ѠQ"%&!L52VQB')!` ?.t˜>*9lJ.qIY jSm\㮶)o 8RN8 WZ ڰ=-Ve߿nzCЪuևqb_ݫiIW53V-hxN6OUK&nxc+ac (yB4- t.,pdƍN1䶕9z V*N6IzSZzU&ޕM~d}m2d&(02#znЪYk,0|!i%.! psӶ"9,(/V=7*ZUA}<Ck0koJ Ȋ%MH,PNg<mܧJv-J句rătȺ#i5jWRI` 8N}(Y7]tD(0D%kB:*P[8IM:שMD %G;0R>uE^QL*LvOo({3Χ9P'NPSWuJ J@:+Un&R؀e*Lڎ%~g 1']r\OQt9p:{H*sfN ()$n'L2z;A)Wlrc>$A~=ΜXQdiM,|hl 42!2 5E JYS/fx#8Q*RUb"ڕ)I4F ќVSK$N ǿt(:LUu/Eov˪9y@C'"٥MFYSQqM7T%(8㑴9BQdʒ䥵A݂q:jTTZ1LM؆ Թ!`C '9>4-:I* _7%3z\^ġ?>,%]>*Js*F'!#9H瑧Kz.}MӠ9ÝA(c8BŦ<*AUM mhH) '623ǜhNؗcOqjMXewT1W#jFbtT|Ršϳ]#;e* YRV\EY#8P>>ԗtڒ*i]Y[BA=yR±#ixYFKjhjWE̚ziYӘbQ?-Ru%f)@sUBfKG= ifnkp>n<>o%8g%<~|ih0`I ڀA`2cRG׳jӐ^~I{8}+cH9 ijTZh,+|A?:x*Zuu)SLw$X>~%GdOީCUilFDEQXq͹߷$[kX7>ҠUVYShQJymqqDWҘm6'A:n‹g.݊Ud*mgz` ZBeOp2k,{Zm3mtFSOgqί?VSVj2ienZRFS$iKbV]RbN!nk)*u'- գ͙vRZɑs %RHxIAD\qqi(U6$`1{\+*lDi]i@ Nfͫ- C(3RS9qjt<9]G#k2ʤ­@#8G82\ FPή+kGUlLjj Za[RBRFAJN>5z65lACZrJQPryH$>t-tE/n3"s6)qġRyT^XͩMv%(Ipp>5tdmy.)nN9_[-FTeZԑϝ9툵 dԩm.!RP̖I|f.H!CMfT^G}*KFIy q$TV@NN/3SmlQoT Qٱb!A D'sReT \pUGfBs,d<^ݎET۶튛fz,뾬_zu-d$)IYń+9%U%DA! \,|rvH:NrJwsϺҝ>NK?X[RmCc-C@ʼn 8:A]RջQ͛iCe*++%I}9'=7 s'T7Z\J֧ 2jk;%N=>,`NJOUeֻ-ΨT%4{)+$+ lB΢5ʥJW&!}crdt|\6 jR̹yiIv422V"`!J#\c܈ Z ^sA81R҄šHZ;jw;GxFok!zl+dZrgogPcۄ Hg+C!R?*ӥKgĕ)Eᖂ˺seRާ\n2ON0nW3 ,QJܣ-莓p 뵲>m[=bٓTZm!83AHǑ&CO۬ ?8yvgƾ}XCskHROlbŝ=YܑKanO!@\JFR|g Dh$JաMad_IyGyj%J` hKOF}Ymh>kV|Kf]Jt֨܁)ž[Y\Q$YڴpA:WJo.Uߦ\vb5Tq@ OHFcjŃSFw GF?~ tk?_ CϊݭOK]XK N(X;FGO)bY{!&|LYRԁ+QIH<V+ 3r/8JK>?F$iהNn2OO{ m 祋c*1b9uh;G 8P]xml:s?eVB7HDmP6'kd_>Wd:@>/Xh$IJ`~tC7Lܫ?K4Ua?A?גrEOVWfEu-W6!!u <w/ėOYΏ~$|?t=#>G?ޏct$#F?nVhC7Lܫ?K4ZUmP$:WWGGPzugQd_>Wd:?% =}gabՏgY_93Vj-_ö (PyK_tm1Ӆ}/ėOY΄ /đP+s6]s@RHϚN}+[:͉Hj )A'Q$O< 5i;ﵾ=_~RTҍN7.V}\ ~tS6ؔvRvjKC'+UTkPzpuO!wUQUZRe[hlQ jH p|lW?ѣF75'LZ/x_9[#̪iS Qihw- Wʂqwq]wUz^f]FR2iPAR'ǾFkXtir<4vrw!@|]JvP”%4֒w r03ƽޔQ˓*P^u}nhZrk"르 edJA9^H-gl:IKTJRrV gR͡JWiB-JS!km̨$=DZSm<}72dBmv;KhPAPB @$rqk:-:,Ӵ8H#x3M7vnT#Nn#6rpxj<ãP(|SetGa-M%A*ܧ~\_#Th}00viHJe #j5kiE\64~sΔgtnY?"9e4] HI9nI13ƏfzSoSbs8b69 VvN%) \MmL)ylvNS':Y."ۇ2U%Du$yL:;(1 vq'}FTlU[V RIjÆT*PX%''?O4%`Vm/JJxBA4 ZYm;$8:Z~Bw(2SR HJ灬Q4n :GIǑ2}EՅq8IJ]i99#bҤ}']Hd𔨔<~><0QAt8${`ښ0)?X3>q8Ih+%@u_! *#7'^kkPR|d-\ 8ʳkKԤ,[R@mTxہp3l 뽵)c܂H%57+v_f5kCZX898ƴ->C PJwY]$)6Džg85̹))%Iu2[ q#wo?{yX~Sf2է /9 8E쩰!I}Q26?[dU*3z]\}!:RCiCgH;J<LqɔՇ=)k @9ymhfqt68X<zNyZa)Qr~&q/Н+31]bQՔ8nT> <FBZV\ʈxm !\ sc+veU:mR8?.y֏\y B$3\aHJR;FHAε-#s@}r?̅xvs[D6\$=J__[-FЂrƘC!y޼O3uR-JG>ϐ< [E)8˙H $+>r4ky,<3'5RmPHZ'8ύd >67%>?g@v W '^GfB@ҍη!KRB`,pS + ;26r?ksdAJO짂E9*J>#8қ+C;ZT`g'xF JѸ({뭋Dvlh:pt2,dߧ':\.Uiy矯u!O."T I(H*?@ ^TӁm%lP^A_nxZɔ$8;vN4sjJ$!'kŔY#+PBpA~ǟ>k44p));S?>u\js-o+!+ W':>,e {{%{qIpXz+/== Iiܒ@0CrvC(?_#ﱊ_q-MIJxY&-sbC)G?2Qw{H*) =}P,9YX!>IccW;YIXFV' >kiFS}Å Fxǝpʖ O9os7JB.*3Fᴄ+@Hם P< u % R, RvӒJO> W!M/8$3vi%SdOeӐ/J'{IDQWvLŗf1z|􌚁[N3*! i% iI2ܒqV,6[v9#ށw늜*1;ȒN'*Bσ&vH!PϏ|밠7 'ݭڊ׀7rI?CuhT})q{ҥ ctFڑcB6(179i,T"-vV%IA >UNW S`/n׍-a*.<^O*P$'; Y.[ͨdn0NHŸruV);FǶjR9%*力!BӃjˋyiX#<C}JUZlUT czJ@))g馪Zi$)A(d>9<83gsi(AP"4Ԟߓ%\|_QceJ[RrTO?:l7)| @m'`' 2Z>8G\ H8EƝ4,766FHI'9G .GlKG$qrżԭIcp~i;Q~#(>)J Q~֐ryIk`p a.=恮җ #kR'#:SevԤ~R9##c_zێ(*N >~G A a\AVR\h+kʕ>*?~)wjr7 `*sM2CȤuV֟r2GVvs fD"r>1$~UjP9׭LiF2җP8J6|Ryl6$:RQdc ϾӠu2<3%$Is{2qCD81 lVZ(![,iAQ"HIzHA^I][\G/,~hGԧU'sA.:#oioq9κ'ZRioJlERJ3`ғcDD?c\W)-m87yZfa#eN\t}wc'^NP9qRHuv4-M A$अr4OMk Z+ڤRR)[)^υqle15+ih2s 87+w>pF~]"Kĺ{9%k`dNApjl2;͸p z!9%E̯fCMht^t(܂A!$gNx\{Mũm )aE n@B9ٔԒAJxPyA*"d$$pqIJ=rP.nMMPUBt%[vٟ.;LTTl2·pNIs<N1*aQM%̵U oH<;7TylPŸKkRpHۖfX" V$`)'p\ 2U& UZep1;p p4cn*|uZ+DQPRpw'a' :؆Īe ui1SZaF{pNOI*wU*KFfcyCP)in<;wԣ' 9Y\Фʧɧ 7Qq,âԛ~Ze'yZ@SiBVS@猪3*usP֭QeHM%/>2 ! ^Z>=틶*bnLC"E-nILWl$$scNJ٤MDT$f^Sb46Uڜ8K~\kb*T1 qHJDŽFrt랏a]I4ȲZSWÅ-Jo Z|8S*%5]!Sj%epf CHڊPA'u3]f Ip_KoFЅ8ҕO>cϙV/pJSr,~KםmךbzOq)%!;D!Sӫ(Ջ"=*dK)ԆeT+9JYlDcPўje=Qߓ% ëRJ)}U+shBJ$]CO(V|sRJ\ ,My:ݩݐ8'KW5qbsѝO騲y' I$!%\9*ZPS-9bVp? .Agz8b{;2];-6)XZ(pH>t$Inb1r93L;J7-乐Aqm6rTUԺ!ۊ㦆y)9|8 ku/}&s]oo&6YP2Kp**9$JMqlV_i)_ٹZ6* 9YSs۴Jc)Pf 2cZi*{sZѻұK[ ɐ r-J[McpX>=>Z)B[4T؇!.-#А#9݅mN(IꚪTefslcoio +ݻs>BZ͌+rըPkPgjf:Gi9r;kZQP^T<2bR*(MiKsN7$Gi^OHk4v'OR1Sؕx*FcǶ:0Ԥ!]㬬,lRq8@림 b]5Nћsp)<GseN0jkP}t- JG$ ^}Tni05ldʧ(jhR2[A Pp7g}1wB.!!- y8W{6E64JS2!M3p>IPږmzMM`[t>+nC*yO}9σ^Ne@* mc %V35 ߣDuI(fNyƜ];˽;tT+!XST0|+ZyLQ"ju܆rS$\$(aTQ1ޏ" :FRRN=?]tDai xjǹ>Iw=ϦȪf1OIrTK <d}̻ ;"OT1R٧̤qRiRBpIj$])4iE INDF3).2QͤrOΟ.ԺըF!2(Om3gSbaOC$m,'903܍6w$xZrSH%_QE\1$\V!g+V²A >wq Ix9P8RYq43#s Ԍ >g:"FDiin%ƙoxB9###DREY28yoHax(PNILL1<'P5<yUNbpEuHP(~Gm'564Jy$tP(f8l'ֵ zқO6 '[R{v6Fr@08Kc4.Ez*(f#¾|Ԓ;NG>AIFH9M=MFyQ(uONR3#AGo|7ZלVU)T@) jRP-r2sl[i##2@i9ZCRiuka-&ӨD"R 9kmF^rEEW([)ڽ1Q&[ƙ)%c(.$}BNxT!sޔU5IJiP0N|G:E"R.Mоӡ֫W~ɨ[܅ \˖[$UuY!0{d# u26ڶKjIj%e 4Kw2'Փ=fӠr*Eiհ-I}4ꔩ[>Vj"U&9OT63=JxH'WArmIOIRC'Ӝ#|I:T"B]3Jsj#c{Js 9)pt.ηnqvTd W$9s. 7kS%$$䑎}e%n-@Yj&݉B$v~+{Ի.ͦGMvRdKe.KO4ԭ!YV߼$GsۈW*r# 6^- g< cOr ݕ' | X .lב8$Nr!nB-!)X $sWm0R-*UFB!ȢGSQkZ[ TʝN"c SXߟN%g5`B֖?B!\9VRst@:A:rѡ\UU*e&), $B(QPHuwVO&Wcؖ?T:-nW+K HnQK -QPV6a;8Jumtʃ>l-K>]ڰv%>1Xvt-ʅ+) d}1z-}r6$$J'H&%VnMNE>傑Hڄ wci1ziޞ.fWO5B#u$?ȍm+RKAԒp~t::H҄ m;d%,R=) SZ[t}uƜrKY, qӄ#9 @G:kTT$\쾄Rڧ$ $VrFAP=*OHU_"J!ɒkJX)p'GM~D8*T7(¦>rIݝ#`$jdUUk6֑q)'ʔBpF8<A4*ud S-S |2p1qVRSV~hQVw:ASiֶmʕ[rX(u9% $/.d `4[Jbs< fCVP;N'$n |gᮟtQRz]-RN@䤌jXlmVKJLrg2IMWJ[2q[ʐ;rW^ˎ@N33]|UTTi|ϩ.7X 䜓OI0)'L1 )XqՆ@JQ8N4l^i֍16llwyEX,|դ-(H Κ TfMh4GB_[x)RWF*e9omj2T\KM J*<?AFkrE8󍸙-Ս c#\cN: 큑q*yΕ C@TLSy@eh>@`ibKK!\} Cj6s@t:ΥďNy :J}I*crqNKSKpo)ICJ NcM"T^*;MNBKv$-2d w+uiFUm.CoÌ-8I8өN^Xaq?UCcXv I9gM=@(7îH[\-!r i9(dzx9ԝhngm}pԗ%n2ցH9^r@ǝg[Dnv2BvO!.^R|cL[0_}b,P#I[2䅝o';x<]ĥgfn[eܶ)KvTic/Tq%i^9>5fb(uӄEOX):]Hن޸+nB(36]i/9(%`V ]jD_ewݹV~ALk񶫲.Ď @)gB{Dzk,Uc<κht}jPc:K{)TI.c$9An{E=[yȕfCG,pH>ҒA jOD>źo1k+M аw%;V'8D%*@m6&zS&_q=IIYl-!!'n >cW*SV#FRL%%nR$ '-]"nqi[ڜ!3xtb.) YRD[ )?Ѯq跽)SpRYj$6rRNAG7v7Urb|3%qiȞ;,%)* WAړ'Pu72jk.9ree _҉$H9#SJՍ.,@Kn\cMю VTSNڝ]B$s˓>K`a I[[)2pCi 2|guƋ2FA2_2r!_:NrKR/IaJ˫*@B' kmqL%U%Il23quù`W*[iڃ<]qI))NwvpGOzTUϬ"Px>" vq6#P}s*1!4DRI'!EJ?QmjU~$JUBNݷ As H%S.QSm!j<+7 PHi< Cm)$)kt#ƦЖhJFfj݂/A#It%?95 2{RU@GSJ7$%d8ۋBԩyIqM:A'%\`m+$k7e:JR@?ڕ09d{j+ͷUsBwvD#`;0rOa(ȶ*QfuYJ0^%Xw9cN"+ur&e2Yyբ<)[R(ʵ$4nVy_.197Jꕙ.+H + !iJ|o՛L\qLUEISOv@W)6p0N1#UJ ,/"nEM$XVbRӭP.l(̻R)!NRFpGo*WWi&UB3A$ZYh72'`sq9ʼ>DSE*픆sQ[ iN!]mHO'OnӺo#Ǹ{BnlqΓ/YGsIp>0qVRˬgmCo4蚊η s\muS$DyO)8?OP]m~Mb-Q֐cP#zG}'p|:tsʗ)Ts&Ӌx)( 3<::;ٖFM-}iD"%Fz CLpa2顋[9W1{;fCW=+HP煀|u/zBlK.T"8jFXSE-X ӣV %"Lsd#SKt6`7#VtTr VNO+jyǪu c7F|~xY:12PVIPJҦF6 ՀԖz;T}2VJDWܖa)OB>5|4dDBҺc/t%Rb;-H K҅ӹkb|eW2mʳZcZUN zKOnz$;aki)%; S:)5:TKN'ygnHQ'D:UV15& ֠KQ'\URٓlԦm.: rG#tֱ+FnR21a*sTAu H۷[NY j餫VyIpDn6[BoNI䓞5p:9][U0&NT9 R %!}Rw i^NZWR2dErPId0w$}&,^rZCNR9 NҎ@Rw`R0q}V{-K3%>6=!2ڄz2 B80`ELBXCϴK[ TFU3?}/zcߗMI-u(SsRVB c/ Z3uʈHp!%*8Ӯ2mX §䬀wqy8 {ƸjiFGvV<A: 2 ʋ))c+$C>u֌{zCzR;nh  cac?MCW6kid%-! KiJFӜp3#jBU+4gn]&+!~肞EaIVq.ÍL*aڏB񂔜q:GZ9ر(.2K@!XHNs"NK)PeGQG YQ!\ -|'><䌞;vTW^ nPp` wӏ@ ޺:GĪFUG1OkI's1UFemB1ʺսO|V3il푮ƹ.g ]HC*$Vka%kG%^Vеq[ԛqg8;G#)0p0A<4 "ϵT9*}cqJڷ%@s#:yW:2%u'e$HB+vg&i_J[BiFRcZkvtLFnF_krT88RH8 7^ *{1\}iԧpRXX8rNqA.;N- JҧA2<4a]_wUPdVӵ%ysjwr23'[$ 6J/!lT22Ijf_ KpkWa-Kr[_\S5uצ]M&m^Әk5$"TDbK?xRrdNsJdwFh"7[NU)Cv_gkGp>< Иj&BST֕xJr ^-q>8d%A>= ǂ3uv4*$m8{RyT}hw$@ulӞfad) ZJU$q*ٻDM˩kl‘F|Hj3f[p7ІH*.+)'vx)NNU!"+闵j9#쾗\u3-uWhG < xrM\uT~"n p\碪v'Ik|t.Lj)n@nCd)+lG@C6}} H5QaT5SݣI9uA*+84{VK7TLRvPRA'g NA']zmJ)*ipQN%{IV0siżU^~J֗#p@% >r Ƣ յUT[NHpTd qOk;*OOSlM5Ò )@:䌍:ٷ5O\4' ;lUn+҇$y8<})&\/DipKrZJv`njO1,U'SPK;1;wp];jx*4(3bG=r7+oR:*8iVo_apm*k8V9IiBeB<yL:JDwpYݟ:P}_tJݖ+=Bf]KPkVGl:՝Ia JVR9ٹ:ztNܞ[Qk1*SJ -݌y-X]aͭ:mnnv:tVwR)9#˧kKaT#u֊g*l}!-(HQ }=uAJVS<%\sN gZ/ rOzҡU&C2\B+G`d7eNGT-qRS2p(;m[}Ztg'a!Iv.w**TT snemc܊"D&cD&88]VP kUsYaSPt\zp䧼${f]K52n؝SNLd0cwODyVoRq"!B0 O 0tBUeSP qhXKmF|󟦆c˷f"!rCHbm !+˅>Q8tӡbZSl r-q'V <#gʰ!'PT(@󩶃rI?<ʛlJR%gq*j$dcƓKd;ti_Fram#nIeb5.3éN>R=C} 1K'8ZGnu7*+ͳV.89gNJI}4HyK;'WW3}ŊřޯL}}\WVI` nN3౮Qf)OP]=ǐZ #pǾtiT(e eJRCL7BVBI>d5UF]ӯjI93q [I{drI)9ը~|S0>GiJP';A~b_̤W % D|=AUbg)%[Jҕz89j7=pKY}qԕ[İNұ `G5Η/bU>UW~ vKvn-6ډ% @ rA, Rm)EJ+jq袜@DxsUbu3jƭ عO%½vT'Qެ*6'U'Wx ;臙҇[$!$AIko]:\a.EOlJ[;Q8W^֒SƜpԹ=f׍6UOuЅQ~u/o\Q[FJ>v؈N[RO'p>|r5JZI{U\2_f\`tKԪUv|H;!;ZFT1rYW MU*"m5(G+35.N-̘Ɗͭ]ZsjueMUZ&EmH@[RdZ,Pِm IϐFv*M^v| BBuuM^Y`f FEk<..K?$V̔;J0=AJևMW.*=]^0'jX^5q+F5u>C^^k!ꠏd5o?վϥ}53+?=|W?c~#4kQC4h+)?RwO]2Cu/Gum/G|P_s5~XM8Dأ]ů|okO:_'5/r? hWGaw="|9QRź 'O:oJDYz:尕VIYcښmcwU/˨RA yOMD*Rr0ީKx>8@0I>kަoI`s6Uh-[G 9AcpH:{R+j1%R8G<+?%OzUBjmq)qYB #c 6MѺ+QhVˑPVpJ@'#:D%n*6 d)}"imV Gpxu3{P"3PF N) FuЩӮ4\#ciTDKl8IPW=wR+l̤-Aˇ>G(ǀЅ>sGB{T9|cλ\Kh+1yU)h)!{_% c' vnǍ&CH#9s>AdT :U-f,Ĥv0? AHH@sfg놧Fjk%;&;+p8D+ RHrR2LXc4S#Ͼ_p $% ʔA϶)SRKӍQI?ʄF)Ǟt2! pǰ~R+CK2qθqW!nAq*W"4'%G8 ; BPw+5kNPJO*Q9’@JAW iQu7$W$-!k η^lb[6 4vg봌=L8㝠CN#pqe'iz S?]&̶QHϧ灮H~dGS,)J -V|%;.s~`{ Sax,jI9]6'duè$qc[Z}buJ{϶Ґ#qJ}>sƷ9V)hv"PG'?kr8aԃ+b[ђAq'x]BQm mIHڅ|uԞqˇ )W'r8vԥE 0썧}?cw{a^fTă4Cޟşߌ?,ל 2e:J$qkJN>@opyNr83gWOqip).19 TGjimmFP׊캤;!:e mG I)A:%%=$HI '֦K%#$D?Aκ--0w+Y!aACϱ']/]mE$%'f8O·>  ~_ƃ7AaJ@V'SZnR"Hi#x(3f O?^5)L8i؄롗n'A֧ZShRc]sRE}ҒoSεDCw^ a }- y#O-BP9 ??kSɎ^ ke%T̈́ol$\sP#8}]1$%oHG.ou4$EeNf0>Q?^-[Z[>} W9??ԑt-DoiY ;TO8OP26@ wOCQJ7yG޷2IyJ gp؟9b}M֍<x#[!};!8Hm>m쌇K#nҬdG =J[ GԜcjKoGGu A!$ң?KN%8sߤv фN| FSSIA% ŠG=ƜbA\Xu a*@*)A،G"U- J&ԗQ8W\Vm@)JA<D9;i9<;R~/ߎD98Sv_9q[4aE=Bm~g_xH 푤Rq*8}֘m+aVVs2>ƀ3S$;gxkTr`#]kZ)eGzQH|LRJђy*$}O瘶P8C8'zF>㬵8P$MY/('p@Ay1lZoHGpS.[C”l~?1D:<g#^q*[޳9H@JO뎜| /TwnA8 I۬ )‡G,a!MN 7H:|!BN?.AO:~gSjV )*ڭ$ !{2VFsA3հO9,'s5Q0R6o-"9NARpr=MhOTXVR\h(웶[,%ydO'ǶŊI\khQ'!^8Ǿ\ovԬ V88:Qv(u[c:AmJ*Ry^Ҽh׹M7s rc>S1_TgRi Ғ7ۖS)iVݧfF3~6%^zA³%_\s:\Lƙh'I+k]Rfml%( ;y$tbdžk)ٱg. ;x*8XK$;o9h&S)'<Nlʇ@VNq}kT%9]+mN0[ Y<} HC Nq\HW| 2Vd .܃~vm9O:Qs5C)ǏolGuI *R:Z6,rOG=>9 Zhd%Q`#KQJI</Ze.ṳ6)$ζ”V9^N5.*NV.G"!I+ pϑ ijw[#ʪoTJ0']!K<#N=%֔AxmO9B}Q{5JÀRpP¿ziD'?4$F0Q$sO>Б5?o! KOrOpqmK&*@m) ǿjs9:n5pLvbzApH?Q6&]}.0TtHI'#$0G堝Xm{9Q+Bl4AYQ8Z$6g5w 9 dY2!䆖5jt%*;Ԡ`$ΰf#P㬧hO0O!imu+!IJSoߠcIe+!;Ov2u|:$gLgIQJJ\@NRҟCGCN R5I#?^|iOzCm %0<2e(OB SMLaSgG9ǾNEAؔ/-J  rqOu tѡmuM(7y8B,wΡ.(`~iw-ZQZ6%؊2jJIڠrA8rX%nLJ!TnДaHύ:nOΏLnKK JPT OG<`Ho*2_kږK:!9# #r=&v; IHʁI8ǜ҈: Y]oy͞VbvΩy;JuF4 lSmPb,s%d8қڄ 88"R PI~Ƿ5L彻 u.ɂV*q\R$\*Q cJu *L! Ɲ2;!ŸqyݒuZSZmT|Jc֢2e:GmZ}@9+ukK}eڵ(MGn;Y” hAIJ9 )rf.'~X6TF6kI=)OdHZuk~jי! Dn.RדJqj=΢{jU1^BS nqj:qAkǕ8΁)6)S qͮ A#r?vE!*Kd7mDbQjUrTO8(lp@@9'jmwV6=E@T#G;R['; #G>Nx(MpXB=AlPOg%B] >MЗz2676 A$Fy }.Tx & K2( sͧTQN7 !J 1NtY$T]L8nj:烝u'ɄZV i*O}u̦P*̷(Ζu86 D'};Tk4ON)[8ĤP#Օ-mcDfV]C"֔)?-@?]KV5:*;H5嶥xU#:quvUXTÈQH wʈ+*;ӏO˲%A@q§]QS;I`gTO[#Ƴu+g74A%DW[P++p'#yAg7%o"q?i\v5m.Q܅RT=IonN#_VKJ5Mz Is$*%ĕ,<Mζtv׮컉mS +\{n%AAIP8 pA_NA8C6T76@?CI::+i]vK8gg$dd ~9iqrB5k񜎥UܓNgT-+݆ki4JꃃݮBZս8IZz֙v֫9K$K+:IRp8 dү}JWܼ2'.A.HF@SI F98E-hW5(/tyO1 $}T~:҇mW(Jļ; ҹ UҔn\/-e~RX[~xlu.}'[EFqQ!99:OSOq[ Ӕ ,+VҜd=DJ^JG1c(<ێ8wd$#λ(юb]r{kurQи;%;Xkʐ=G|}^gM~󶭸a-FҘJh6q5U?3{IMRp֟sHXHi['WND;ݚe4eR I9?S[NݳTESbLm8 @#^oO)&b;g)NwS4-[h\^ `p3#~jrE͏`I;W-Vصx$yyr3$n!dOTJLD'4ĩ1Ag‰A;2Gc8S>ѨՙrP\miTQN$s:x%ZTsTSSiLu)% >@'#?\Ti/C2,p'IiI3ﭲ*BYmթJ$ƴD0"ZXQ/6 p}>8S*Q2p7Gy5hS/u;,TT'$ jQ_ѩ"RNv)TFmVx'ߌxMm U zI6ʟnT%НͫZ^6zFSΚ)Q I46dd>U+WVݕ݆GULлEBJh5 n.= PA.U:[pS#M5zuDBdL`u"uYReϡT=>qNl;YXqMA  ~!_N^5?AK\N`k_NTv *<$mw(cF8ΤORcηޢljL IyUcԡʀ'HdhRMr PzOHV"6. *0I ?ju˨6O,zUMuE؍展82= !xՍh8 ڲG3Xl[+ 3*TO# leY@:5S}v"6 Ô-u?pVޓNrJ D\/睪 ƞ6튌@wc|q6YQƹ:bTV amSQB@NG8HE-ߙdՑOOuHtɳ/j2uhJR! (s>EUNw=R5r5((nK )Ă=':l}VT[TuT$SLWQIRу a\yŹFTJUEyQ S˲JJ]Qʲ tVmJ}muy,E$(g9% |FmNû$@ Ιi3HWmTrNԎBcߑGFyÑIS. D9 kwOYU-{g^}rٯtPzاʬMN 瑃fW-/!\`jp3G\HRBӈJIy ،:huRO[[]?dJ>@>|iĭ ST!KZq@K0]Ijz=.֟-)gJp8<浪?P-(T:J˩Ȥ͡E[CorԇCԓ*?/z!$GuLGFM^X#$J YuK5JDZp[x Ic#l^tL]ّiLJ4Rp79?CWӋو-U#SLV4lV"rV 0 sGn]4o]MVڕ1i%ٌTT6I$rIΡźziӊ]r!Z&V}:Gmے1GE(r:-M-MT'?眬ouV7nR8cU{+*T%~I >)Dm**F]?*P&6PD:+$`cZ]{)JۡΡ߭b <%%ɕ\>bKAj psgg՟ĮiJKSfYBYn3J %v!j , ՟_n};5yqn`d-im+ Rfa[Ջ+mԅ D@Np~{PzjVzi+uϗ1o!zAyJIz9:yr;T8s)8q84qľi7dyƝkZi˩BrV Tdmu[I8<^+n9PX^MhNf gY9C ې37N;Ez_GH(ԉM,W%HVr@8:|۝2rnRrНRⅧ҄ @I)8϶ _ SK2_ DrJ7 4JwxO/'MML{B-:88ΕWErTŶBY~Ce#*Oޟ83QJqMJ7d rtصk3dT PeH܂n'$~">tQ5٤ع˲MJDYSt)A(Ap}ZK^,n.Y4Ǥ[1G ~Q;imʘ&SDG!.(!#% /E.Vil;I-Ӟڤ1ϟ@ vS/CIUw#:T$8ryI@d<ԷN7w7QR6(̽J%-mCAM u4޾QBlwbS%Lܐ RTTrq FqåO[^_j4##S1*ݺQ!`VI|h :+RO>b;j@c@s5`~meBSKmRLj-Z<-*޴9u4U6]MG1)SBJ+]GL*j-M4pU BN}:{zw5Pc6 <'{}69qzeHZY| IY$ou.`6rsW k:IfԣԚ\[u)ZK+JͶ>. '9Ckg_q_quw&![Զ֤EĕU2KU)fn d` A;jR R-%+"ţmT9* )qgJvJPq+>4߶D!Jaʔ@Yԡp=4ѣD nŴGL'>-9$ pmw> t*gA A>H+r=-4{er|8|2+ ?]Bf| R]qͿQTkX Z }J! ;P+¨nRy,;Q~|GsRT^!$+#զ E{eQ0>لaS>b nJqI†FuKGݻ.K1 I9 F6%{ϦZ`f@ViDe~ HyXnm8ϡMܟRv<?VJT Cjf1eOBPr}jQ0~KJp}Ƴ+-7ц'K~!jțYc˥הNy6y獇?=Υ?VTSKShytպӯ0 ,(RVI?_yJvLkRz: P(O6[-hXm;qrN !j0Uf,ڏuKQJ0G寞.L*F򒙌#{=?%!)OFo[TُS]!Ih+AHRrRNq1lގ Ԛ;ݦ-I3j APZ RmU:4^SGRUn[ZOǤ$ԧQRݵ[yqkN{YU%׏L%Id2-H r90]~+:@l>ԬHtLSASm(U!DϑϝLP؟iPYd\W;Z锴T㺔)YRp*''V .dWeͫ侐wrVӍ(<~GJpdƦ!`^a9דNV%r!DrjIVJw'@< -Mݑ(Hz-TY4.J!]fdiL@@+*H$gM;hrSbbKĥ eNcr {d +_YZBgek@y+Py CH^8ǿϸj8~3*Q۶`Ea>3;rGon2=@lU)$N>aH?}sHaR紀FZC' gxϾ9Θ}1굗V Yvo\jKH9l8;RQ"ө%ø-JڶT|nOcUINJܡOy]2ޕ5U-*} FB+p3tD!EDU-CJ%NUY ~mLfA\ĭ$#$m NuW>""s@pE6)Qݜn>9Qf$71JuLJ_ TH!5=TDIHVwEp*_UI.8R`p>nioZE5 ćS QqMT26hPnEEHMuP:u%VD;sFCcn#J-Vp4ܙSƒ)CGk X ~sRa"g l[(XVU P*?R}%@_ƒ:roKaOR {ZnuEa-٘! yHnǤg<Sԗ+օӉI) $O{OUb^$>*Fh‹JO ;pup7+6?U:T }ƔBnϑJ֧U#LQ r@NR}m%HR6ϫ<2]v*¨hENE11Hq $vd$߭K 23Jkg!˦ڡ[XOyqHRR`#HeaԺ!UH6IiNB$5}~UwθbĐ'#X;pqO~#\FxeO- .m BRqƛ֦TbJA*9;7(6+׵j଱*k4e1XUXn$sɚĸj"C d:IഀT8$O:kԪ2c>*__[{BRG>yxӦv^rQdT\;9MBi%.lQޜfj06{-Y#!I)VvO/QQ(Wʖ%74ێ` 8stV[BBvV88'ޮm)V.(.ڧ7)EG*`s4Zt\r>v ɨBTyh$ )<\nT*D*NvyFW4)Aq[!$ c#NcNLѪ^_a q)kJ ~{_m:\:*KxkMz7,I}ttSȴRUIS\yIm$I*<}NORj5y4ڳj4Tֶ`y;sIͩ8}Ƭy_ΡBȘwZmRx,I#N03[PU-rDr*~Cn㤒Rh0O5-ziQ[Ju:sc)G? (z|I>&]cSRt:K%CM;o HJH`~p|kx\ 6vWZFҒ3=ƕfT"[Ui.-ڔm2i,E;*VV~QKv,(Q]JĖJG+4KXu*WRV@ʉ:BQguڧ(5c$TQZ2IiNT*v5AuGWn WLδ&d(JB$tt5^VEqDFfu? 7l l)6ت܌s %)l]XmdZStV)~R+NVA+^8;)D9]]ɶ~^T%rcӛf p*)!%ImӐ$CrOakV38XϢ5z<:q8JFsj^A8KadGp- RT5Czyvkh_^\ͽhWu3$(*H9ړ9ZtƩYGeAN($`Ou)j4 lɊnʔd)qK⍾x=eHW(!E edł?-So.<ӯ71rL%%WHΤ[Z\mn:>JyQ!~# ϟiE5b!Sۊg˅ jŵ- d`r7$ݓju_.Ƴ.T:| jB_nU s¸հVJ5KWJHBy-$ #M`IYctr:1:"QKUOpjW1|{R"cRp4)#QKsS.XRd_a.7! 򕬀y$Rm:YD!|ZH]>)wSb-b`A\!Ϳ02q"|SS ۊʖ'*pe){zf@UF3FJveGT>N8v[NKLbޤ!Ge8 t8ƕV\6ITVJڎk?>5 #Y؃- 9 ~FSR[S 7G0ڲ q| %]=?m$Aˀ㥥4m9ϰ$ET"=⸄Sk 0[9Ɯmr?$!\@Jցg*XKQ* Þ3jC܀7!8g4r۴Z"'\i h* Nq8E^njBv9С< MH Ѯg)aE?kn`Iڢ19'#.C9f"Fp4I [QKjX91fsU5 iï֠RTmް;9<MG=7f/bo[ q)P!* rtuC%HQvucK @VvP89{b=ːfp8sΜVQKU\)K Wnp|u%d̂ж5hJ?O#Iwl njfiiil{6*^rr@8^p]iU/ 3鵔C?(T\9tZq_ P/)HJcn>CqYY[m$S* yxrڔAIRˆvS*2whҌTZqNNSg$EӾYRR+Tu@JHN@(TwI:DkKnJr f'Az ݨD*}(v2PU0N Ǹ՚:|G.z_ #DȏSCN1!8Ө(Z <`N|x|Ni^Yő%-ۊ75'LZ/x_9[# #>GMl*m8$UEAȒLu[/%cr8pEIYn3{Yq8rF3닮=>Zf3YB^lA<>ji=p1nC(T^A)@D>|xt2eN ^28| :з{o&-75WX --B9)>8OZ*VH'Ml3kҔmr??: +;?x85Y]j:n$DkjR3J! QB |M@#Sڒӛ yYLUBrQoJ{އkxF6)#rǶ۸dK8IRG',[ 딚UF~=mR]VNHKA _aƪ~qsRJB>|Fq(f ,2̩)J>g$H>G"Iq6B屰 j*X/hUڵb5MXU.~Eh~ݑHCa XIJA| sƸ2?r ;_?8}u\5I/ YBv qt$2u*?Ov)njRXSżI3tRa׉yǃa`9IT>5N%(%$`yθebG)mė6$@5lmC tG?tFJT*'+'r@:vGmFL[Ϛ)%ȿpc'،U1Q)+ٸ=gB25\JAVBi1236BTOq%H8獠`b˜}im̄;]2H\)A!JVCYRv;px&HCJPR|qH[TFq$sq&bJS͌Y[VSCcGTq ntYQiv2O83*<*"{k8?`G魒8v#~XqiNRaI$.[}eX+#Gg%%*ܠ }1M1yU#%A_2|``.yqH@X+>rsoQ't Өsb"dJTH=ʓ~vOv!7 N=Mh1,لzIXGT(s~>VOte+>zQl>Q{(de)I%*Qw?M R* pH2}X#2jRr@#^DCq]8e†t1n IYG nRjVH ܔ ~%/6S2qdgQ4r Jԟ#=@|cZӁ{h%Xg9:ٔ TRC?/($(##ry +Bb=Q$ת-F_vB#F늧uA@wd/jwrG9eܲKR VEKNnfӊʛBAV^J*\543SXt/i>1Kv9U:&>m9K'!KI*v]"K\c(%ktgH>>ԏR3 :cPT"l|0|r}knR[(DT)mKv3_g >;#-CKࡷ0$"Z &Ki?`$ FjlZONT%{Uu{<+'#;+9iAuD"!}2)% ?$ cr{YXvp 0ў{Q'%Y]?ŤGO7!0I';TAԂ s%-)KSm8B[Fy#q:Nv 2+M,JSIִiSڎ02Kwғ e<֦.y)v2@@$ĐA#騪58DG$3Nyha 42ʙY4\v? srJ*}xҫ.>AkD |`| 2iw,(i) j#%5@ *Yʊ.%6s$Ub*6Qޣ?MF'Jk$]bs iKX;wyҋ]3kd̷Sn; ”$< >M~;p'Ve!IJI#$5m6왴uLD1Pz:!!jYHqN͛[z{S،$znZ6rx8"kdi-`m* #JǑJm!Ω ! x$@iRNK:d'VJ9-GW9 J2nRQJ(7\eM8**O ')8q4ƍԊeWX@_NfL׏8WQ4yy-h#zyHQ8NHr9&5"9o>B#EjN# g cƧP27(:SCWdĄ<ש#fHlI'oگuzرQ*m(aČR)ߒ}\FZJ%>SIVyOh~ RBўڜP zxu'ؔL9 PAnܒ9϶dX'"=QN!!hwj\GNn}wI#odv\֔a@_Ɗr'|RQB}?-4!ӡmG}(ԟ563BX8PAcqZOMmk%%qG W2Ը`P[LR6υ$?/ag;X)p`À>]m*BϱΓ+QtOiB((y>5g[K)UPJV~"P)Rpqι_ZZ (rr|8G!)Jy䯻=R@ܒ}4bhv8# ZeI{'f8}r3l6ۈ><5q}-qJrx8<_F&4iHk%Ԥ)υNbۺXKAVXmĭUJQ<t4Sv0Si_ 9􀱑~xph$;s3mWk;'l^;6}wvԭŴ NH$u&mHD:*YFU.NTK/,.43qqnȕzFRF~]wlK,1X.(H>9Ӵ&p8h-2 +vSuqFQP JAi!iBy)VAG\V yN,m{$-qn:y3i]) m4R_6$`zEB9z23Ò#$4+" RVi pn3?LkKPͥšڀ`_A-miIw'c"qrԲFO<ד+KT2$iJV3`>5SK$Ԛ[[L)¬gR%Q>CQRW AiXG^%<9:g:w%;!`~xס*+o~DxMJ܉Q݀pI-@yq:M*ekar*Q;Ō(r(,G!j쒵6_f(nO(ǰƲZULUE;~_]E*3dlؿX#i'i>EZCuI! !$(aH ={C8cOCot(^G<^p5*jÈSRԕGÛpP9~GM(bJۻr6sFj1ȓQaTx,V3ْy[i.mܶOg><[6Xʧ{%9,@p8ߙn6hzJTSDV'hppμ[awX.v,(8yO#>5*vő="hvHQG! xrAMBbjHKd!N( %<g,&ٱ) @; r')A#: _rT^[%,*Q>!C#>ꚕM^z(%q-j ZN=+xp(+r1?\9q7J]ߢoȦH%M)-w$W #;fϠZei~Qu.)ƃj(VnsN9t<.T*v"])%B?(%*}PLC\&<(\t))Y[k'8V)mBt&ܦa)XRp0O2xK1"=sR; m/A$uOިIKpj״feY>SQO!ϓB ϟXesޙHyMJ-[X wF9~tBi[Mb$7O'h^ٿU4X$>Ao6JmhIB>/y}* *257J qaONtկN-ȬF/$V'yi)&"(*dCQBN{IJJ+"␪j1=fz:ލdw#c9ZGDJ:U2lGFڨûI qA$53k(#w3!MRR 4Su:칑zÎHbe6v !#q!XoGSgDĩRDfT Jx S'>2sn͠8aWU[S9A lO9fEm!Tu[7%!\}MU=Ȃ]&cW9Ks؋"t)kVGTş^ I]2S"b:wlh8'44_"Qi4Ve8Vi,o$8s(qvuq4\Amǂ [SS8+>k]yPvd![F('m?D}KLu&uoS7.XfQ֘lFRvKeE [XϝNNcO' K&4_Gp{$3 qq~\aÖSbBcDD-6NO'Nv tWVe/CʙU!M)x=/Itg&Wany!$)} :jVNQO2XFJK)+N?Ftw߶-j,ϥ+qB;Vg4Tf >EJa.:kue2WjX [2 Gl%Нm*\cԾGmSUk9j" )ő)īZV8mRH]2u[=n3\ZH ( N5Iq 5(9{p1YWR+{75u2QV}{mͥ#I ݹWeh"dqqN8sڞSuW5::* Pܕ iaH +*N܀u&U'~-rc ZsH* (ʷi'|5IP-cRYzoqP0JKjIH ²@ZNRA;ƭuuCe[Rtp#Jp'oNe\]FO~ Rl$KRKSp0qFlRDnsl+GrvZ겙Bq_+pWc v}ҿJŭHD\q.:Fܨ!IRI `=!B)?9`@cȑX1*u$e8 ֹ6:5ZPU1 TgKHF Q8_U!,e>R31 餥s*rU.Dre:BZ%IVpMwݲE6]'@=<{JW V\=LC T:;kQ$)GsinUJ(Z;p;OnM]Vddr2HdhQ\5XJ9R=jF.84]S+ZdǏ%[ og8ڡg8GU^ԇKV GJ#p\FrefrFZ[l>|'.I#5*LI"rc.D(12q,*J8NG9RXk]mvخ{ -*yzkCR@\W8n%: ʒH%E*OEd -Oݛ:- bA%;N5uRb1qM <\l !yQ:lnŷ:&'I}bI=RJȝzS~.6)D O@XJKϺ P9ϸqtVBUKQ[<XPRV8 Ns vX-6#;8S;$aouTzmz".;M _OE]4W=Qy"% N[ K]Q #Mm)ȓ1Fj9e +#iQl9F.xҫzTfʚÙ!,6I+ :n5JMZvڬ.KSQr[VHpDtMJCLf&Q_i QB 0734φtW}^Mbܭ(h&7ٴfJ62kk)@ <*<)W,ˢqit+Б*.noyRrAՃn1MHy@'fIVY^48*{ԖCxTmNDbDJU":ʳ`~~z|C4 >zqjRTN[m@' A\;Yrȱ_X]AS+1MESEIq{P;H:ԛ3#RPۉ;r)Gܐ2TI_IΆ.7fKiUW=D6laG%%d5 z:L@iTJ- |)tåv} .m)+PJH#Fmk*Q -'>]Pa0ۂczUyxPSifǩr`ʐH| 4 oJctju: ~C BғajX<`cY x6PjwRر*HS'=[~RUIDJtpđ׌GwR+/Wmo\ SSj2T6FF–I+IOi{m I=r*W%Db8#|tDTcSVT6ش"4%2>t|~'s'\bE[E"gXٸ#tS- 5=؋.?ʃJF􅐱΢MݳCmK2a?\X%*O#r> I+ 6RNږOJo3:IioSUCɓ'rաrH>Nٔޠ9"OMhSe %V pNU4rծu WE5}:J`]C쨌ۊh9N5e:Ex >9 Uj"#!nR\Bw6}B؆dgPT-I`'uۭB\k+VJnPs*.% tutF]MIU .e)NҒ9$ɽu2li]X6JvZnX]P%>FЇ$xv٬(J' .ηb }{ $xݏ΢"bH]c1nꍘZLvLԏTu)X˫F}%X LzEMy_~ •N\[mjIW goOo1RqL}GTRI\!'q8  ;J?MԶbJv xTAL-6M%eWH JN1xk[_EFw-Q)@tFԔYZH*W:zVL4jVXr*V6OΝTTT ΂X*;cwp+q$(y:o)'dz.ێp/MiNsʓcd:N"܅ݦ\CYu B)^x};i;WuRǺd"#VBNhY`x7KI6vSfJ7TGoh6mjQsk+3ՈQޛe`mI1u=);5~u!IR#8I]v_jEyTIh0 ϶u'TDݔ"ܓRF>J{qt%Zܱq ]Z@"fWUD05("4Rۈ8J~( >%oT\Dv%SfB}Un.!)R[ovV2 tj*tNUV=ImIچyJRJ܄8<K&ؤ.ޓs&֪ƥ=-D)BKڔ 7_N.Աhv"Qڑ.FQk]!GS>1)-&@\`N1:)?e>mJЗ a*<29 k?cI%'0?'S9FW+ƎuTNTjTXd|(67  ;4 (b֨ KO)7v8΢⚹.bM$h{8PAiH)QB$ʿ]R$޴ԧ>%uR#JJ%k;IJBj6 kh=$oHrz%D{pX?}+Fڕ;i <F.oCCm~znPn%6T;O"hOU=a$~K98~:.+bMZ%l"5܂ V8ʺjs[$w-T|~G:q_z芇{.I#ѼơyK Ϩ'7[cČ䜌-hP|:XiMݼ> 8.ѽrPOֶaD4P @ RSCM ˡG6nݷf%j7jEI7c^RPn )+:=K%ɢtx2)m[pI26cLJDO P?sUbqw)żT8Yg\tr5!GSY/*XEjքH# g<jD e -e${Βj_?*q!Jus ۝,)TsR0m[+^WFM40v;y<'^Xe s)NaSҥ-iQF{5 ۟ W~ץB ic)qq8iotú!SڬM5"ӌx#rGizEB )-5.D@ZWHBR8;s:+}I|yYDiNqťc!\yo:t7fҾڌJC*x2_.%|֋ӧtZHÀXv[6N\ R#]iSPvtBrLө#>ciZ4k!I- zf[Y Y-V][Ҩm@8B$> AMGrzvIjsAskp7盅 )+CzIBF RTuѯ;ףL|V*P).By}i@%pRmBLg檣n2K!4'LCvtZwʹ!R90Doڥ)Gt#hFէ[(:.dRZrS  :58"mV6<<) y?BTV03&eu6iLK*OoSO=%[` "?vڒkBqJI/K(B'$'>|iU/N5Uer;JI zZ; w'cRȷ4E_Sj+`ˍgWA BTdT}I)rƏ,Q7[mĆVv$^&O#Rȏ%oH۴n%Y çR-]OrQZcdrFmT|T NA#RɮA[M.kJEߞXosjBmJ=$a)^ RR|R*ˮēR sw T$rmKrJR7jxL5b֙R+nF9NJs] UY=zh:g<%+mX NG:\ jX۹ lrU&F^ƨӖST8)K0#r7FtWĺ%o2'Ը)c1VՕt  ~=@R*NG?JwP~Ugr]ehR##9>Uw"\ TݩJ2Zd6L,zˬ84nCaARN?W4S0ׂ=&wP\ 1RYx )ĨsRǶ&={trOjAqT:%\/ZB 8F>Z(< |JK4ɧ~Ylv$I9 |үgG/zn.WmQe|FWeҐ=W -)PBbIyTgc y^2+:ds̀v4Ja >|o$͗lʧ;rTǠ9''RNNtVRP”` < dKKϖkMO_a-0۽!C(VN8M. Э(D MVי%%K q/g/n*ǃd댮Ոu+Q^x*uC |='rB03Wn7-`k2c$FA ul-թdJ >Ru`+};7ӂeaԡP*i-NAʼLgH*tکAm!PIAlr19ӢlV"e!]쒤xNkk6P'Hx%IC8#X;Zټ'ZZܣYL'icDsԷd}xPߍŶnnG~U.qMVq.L+N֗c RWcqBQZ/ /&YVNkYFC4anE /+S9W ƣNOO4ч^PPZ4qyu9&O@RZm倴㍙qipt~[έS$I8 JΕmm)(CR}qʐHv~ )"0TЊ 1F~X'I+?Ekvd/֌*UpzG*͠•"*-8H^ps RIԡόK6ƺ(]Yu3/Z!=R oR8S횫'Qaʀmym !PP#c![Fl5-5̼=8 #|ӊ)"o%%Ti`_T@>iuʯTP򸱋H?{v ##vP./iH|~c\9Ne4 "9*cϓƶQcRخtsU/֥zUxƺKpU:_0 Z0wC#8 3*EVo܊}m dvڤ~A?7M(fظUERcUpQQm'v@ 89'T*CDiR!-9TNy8ԛg]NP=zSïmV>2ؿr[-?;q'oq'mWCr*mLb9ǒA(~#_(r{)^/Q*Y\ky@T+rxrsj 5mz׽n>aUm*|h@R<87˚wGRdBVYnCeϕBOuS3kL?. n}&mRq%MyaYc:ׄJ͙̏W"#&?y}!DqpQ];LU'{ t) @ q琢eHvַU=})+S;O;ئz߸^T%Dug`P4 V0}3CK(}L 4P2g*CU> #nJs_ǥ-T X>O?V||4PKd%cI#RmZH眆&;O ?SgP,˝ v  KƔ9Z=Λ7CI ƓO-A-xIAQ㓌+k͋6Hm`$ , <#]Af2rtEXӎ3kpp7Bn?h}迴U~6SFe't}sC0%'G7Sad: ݥ$xR8xiZBy?'cEGuZm]ZT CԽ}Pæ&;p{ NN|G鷕>LxDuĖ`ÈahY $#=o5kJN8[ZAa#&:o2HlHs5moO<zoȅwqU*2[!*rWӃ'; H<`[~dɍPYPjHq2_O%K,R֞F9Ֆ~$=yOS,mԐ[q!AI<N.G䴶g:[Sx|-jI$m'Vửʻb?l -t IRr9{G/ć-O'2eakO;GF.= ]^Cf9[-g6#β^'O..|7E^:gޔߓNjGnBMM0A BR8ξzgz[YOR,x]XB_d@{6A$ƾTcX0ޏN–MmF IIU>b7-#'vc&kIikxr5uPҏ% 'b?A;r^m/_w,H9~O BO B׿|2?⚷Og@E 빒Ԕ3!NʖAR<#4p'%kYUR9E^-cVnj2]چSS:*Ru’3wsi*[J4]ٿ>BN8rqߧƣι ZӗTA$x}KM6XTgy%* H\.^42-Wx9i&7uCK`؍rsS3j<M%+ڕ)J9Vô/:1Ӈ[onߦ-*JhϝLQZN\ԡ8NO{x:c|ZRϥ$I>5j4[;BFp*oqFsG88Τ:ݗbS5X z9u<vTX.- 9VĠRڔO[<I/%9r}/:a[QAj+ !D`~te2:TQ%6>%#NN(3-#1G1-Q[J,\cՎ?:QeI-_2%9H #Q*=61k(&Ku:űJ9 ԅPSJF$=.dX XRiVr1 (8.(5#ΩíJv\ς9<:$\Yl%eȨwc~4ܘ380- bӃ's8>GR3:J\vLUFYyҷٻ!9λyПAD V#$>Hp ڏ 8ҌӦG4w#<:ciHoQ"[Gy$ӷ~Z`{\TZtd3PyL\y͈ `8PqRrptN..z#4P(uw)R( #uЫUäXz)#j6VFέV:oN[bǜ(RU#Y c $ ߬kFHŽƌ[zӮ5i2~˘K%BԄ XV9?ҪQ'*S%ZQn4]5 wdBԞYZN1ߌ^R:*SRqfCi: Os9?_ j1u%Bp0ZC]HuU )L_3OK W;$Q%Isej5& UaDHpGoY qgTGU rB8Lj)R))Rr}@g#y#:H!- Ү IW #\}VY(a+ TlOH%D {Qԥ*UFf-m3(J{g:~cIu#W Za8z/ *I9I>dHt63C؝2;}Sl7HzRd6YllFNѻdgf[UHKSL(* ?[zs[ Q* `!O8 ~,jCmS֠w(r@=MɅ=EZ)MkxnSY`烙 ܊L7Je3Z1r t(dN̆:}KHjTbAy,oQmE- pxԷ; Jtha$HtދnJ\jHϐ|Ĉ[o%͠H9Ԩ<FC駪#p]k4ImSdP$!9\H Ǿ`:Ӫ;ĢK[ƀdOږےu6iU.' ,Ka<N%T]h؏ojuBԕ+҃)-Q2CmJJ~JF0=šWτۄT$b1~ܯS'dRKwT1G6z_)Qn/TWDM950_qnr2xߧPõ(j?2K|~J{O$c5^ xZ7mYn8iJhWj xύ[F4ݾ;*)ős>ӜU-&~eMZ賒?ʎ=v7sFHLw!GDS)a  a.zRI5k yi|RUW8Y% $*篕TFQ#RC++]Nɪj#`+xZ\)%FFF'U"ul*:qɔB_ +G88>4\z|y*Kh (yK3{Ǹq,VANOMځu2ܪНn" ,d $3GTj}NC~H*@ @_>HWiȔ6{c{^H90Ri橴XP$].1k(ÓIuDc-(dxE+N$GRƒrTB#oJ-4?So.#*8XR;)W FvcQ*Ȥ.;hRmm/zHH>_vkRQ)$48)I9]$6u$j`\؀w ĕUqq^K U<2Ėgս_C'Nx[^z[R}8j hq 9A'Ct݇aC$RN#8ǝfc] Sh$nur^KE-PRĄ$H0@֘sQ &PahV)><}~k[lM&Ʀ3i"cCĺa>F3Ld $1N1[IV '|pUeeC!e䀮JA9ITtTw .@3ZZmד($%`p=֧XDruh0R| l2O Ƕ1HKO1+ߖNGVX``Ƽ}詚YqA=+ܕ#gst%,1()! 9$<֕r=2,vR%%LJ2NG>9#~_mmEvLYt͒Q2EA!QR$#퓹KPZQq,$p?S$FtLii-۠6OГr9'i]uU-.L4_sjW,19BaC dƥ>@Hn"̹M T(hp8pNaL<<s R9<tKo8JYe,Xq\*M=*B^,\K8Oyλ"Քm–TԵ} ?@#[Lĥ*,DtjH!#QD6^u2D׭6#]R "vhpΣ,&M7 =6L҄) *H}:ߩM0N4Ԥ(wd'**$iNɌ_%;m $}Β#eEntlǪWK%*'nIJI4ط$͜[!+kC;Go<1>P:%XH>$d\&8Ybs+PgQ96|wdqٴۦDrRć [“Y'5`k4ziuh(ua;$9a2-nDŽq3kR#pŢU]2,bƂ얐-`DdN5;r;nE¸|UĂFBF9Θ5j}M?(mfgݓGm|BTRUBpy4<Թ-IfeE$#x$JFVM 3]bC,A p >4mԙ?rY.6tn' 󹳿V?qTϲ)P EPFG qHUі!Җ>m(I8$4EiXq-$k-nXQ >=a1"+H\@C( ߞ҅6#G5'aJэ:кe}iHOiww:B|r}tyeտ[b$;6I PP z:gIQiNZ ,JB\C烂A>5Miɳh:v)Q3F}U) T !}F9κb@א*XbSՃ  <{5ɯDTc})jĥ۫ݹ*mGv@ynnW2Ua4ս=Km|cU9+y;'Aƕ#[z.F_t7n[+JSjR9@>?~nzgBpږ̧JS$m*-)I#OfSu*ɉe2_i (5VOM )K u %J)+݌qB*dj2J+sƛ7!ɉLD|h1}*M\2ʂĆU8瑥oV}vd;-?ӹ$ΡJ: jE6MQ"1Ic<qdt& 50w:T̥ So$I$<Zrc۞ؘimAo8(J$ i:j*xH>6E:̼!)<K*$n$#әπmF"¹gSԂJINq?ӑ ְdNѭjL]]aJJ%w8NJFUd^4OcNR::Ӆ! Y$pRZ>) -`N:4܇d:BB%D'WKw2 5աU nNor)[[HݝN@<(vf>)l䂃zZc}2PR`ԧ-DZ>/cרR:QvtT? hV'֑ǎI`p۶uYmuBb )C~EI#i=ڋIA<#L~%}ըop(䑻7!*w@xRr{Ҡ-GixPB~,/I%mizuFKZϱ)KmFȩKLI˒6=dA #@ +#3bT[C:O$mR@Q-VHXB[pJ;qF9{n}LL'{b@xO-9?k* ~^d45:|prPpy'qtj'bں=:^qLs처vӽa:E HKn o;)91ˋGU멩2[& 4# gduF H\Ph w%8!:Uyqd>ϫ!„O@uRH2px:ͫ=6z 3%m/((Vje"ιj˭ƧM^ 1MU3}FWʁHFT-}=JNSHѨ_%H,$W +0\*e56\@{ #9W xm.6&Sum¸Bm!}S9yV-ZM\Lq@ Qǁjкq6RR! 3%IB0qH#oNZgI.5r4;VaWjNUqd0՚jkDd˂r<C "SǨxXR2IGz"vcg*8J+ʔQd:47$u(a 9#r~ȖbO}%aJ6%^@ t)hs BH }' BTڕG?xԈke %@ YPVҬ M:$ T PKFub5UT[~~ѐl>}P+sySSΛ)t{-˻O%U$E4E!C!@2N=Xo 46-I06|jYߕ*s5Ih[J0] 8p9<=l[TZZ¹ۍ{QpSZ%̈́-G2AyӐlRO&!R\R (ێ9ʸボiN]B6JW5AJl42Oo%X~32JZ4 iyO%2W8Hn ʢU*GpM."kPބ@ړ8^EKDyf) w`?UxtpuJؤ_五4,NW}PVtQzYYUv;1*"Y)IRP m wԑWzN`d"y(So(-y$QN헃Xz+v 0}/3D?gz\6 # <' l=MTC5T:WԷz+jy̕zI;Oh*,$_[ xs*inXr'zmv˳P#D$BR<$:M'둢S[[e&"G)Rp$)I}_ ],aԢ29t e)m N IXsł+TڽBTsBϴ")y D~ 5xJZDi,"g;A8Zi|9)U&&&@&RTy(!GhOuc#Q)rkuJxp)ôyYKb)/m6=?rd qu"M[`1<{/m(%@zyOĽZ$FY+@& 6JJ*T-GT&U2橨JJGq*ޭ$m8p5.ڴeRʨj.:(BF$c<}uMZ]Q\(|@[ɩ)@eJCY%JP$P[z&Ҹ*]0-6(ΚSmAI-;۫9gRz;H#oMjo4?-\wGxHBWN#xU_/.Po Mٶs%2.id Ρ*KyI"ڳ+TPaV_}H)iO=kY-ڎ͵^9)N!d)pF=޷'Z3S& !))%FScЯOr$7дII;3ǝ ]dXΏsTk>q%B@eiJ\ʛx` tIɤ6MT+^a I <%G@:uU9F >pⲥn!!6aիջ<(VkWhV!Q.&=BڥRHƑij%VOi&2_lz$Y*NR)NSř-Py qI2BAHmǶs5UܦQ5L 3!=eRw%F4iʜfbWiΡ5VFBʇ+@ukO&/ 70QnDpY4Y~9p JJK~yW.ZFu" '$4)iA8Wt v& @)TQ!*d>9)i^ҵ(`0ALqj"eve\w2kPJ8%*< }u`/{jqZJ[r@@)_tk-Z~)nC'JJQϐyՄzhq.Ynd( <SBw3Dg,ϮY7mSN' ::K{ӡU;f";pڧyIqs8>#_K~. c.&fcrI}M$l$p5@/.SܸUҡCm.;5M%WHVĬ`$Il2lj Fe)IJF3/ʸEOW T>ie6(BTyƟWf/CcV\TXuP^b<pxt靿.ۼox 2&nZy=YQsjm*ROĖZe+5οur"QW#Ĩ͐8`62Hq”d3W鬖:Jz= PG' H璥(1Ƭi7#{_BzLF[Sq ̔+N6 (W wPCҧ{ .>%@IKKjueR'>@2cjSL6'ڽqd[u>P@̳~%inSꅵX 萭LHZ#sRvhqDYimE[< d]*z֯Nk~FqƫA.ˡ76a6ړw'+WuuG a91i0;H\5VyNف7W5 NeE>d kNNɴe5#腩ǓfڷZ.FB>]) 4[S9yZO>vyn4Hbj[R򤀕qG믞 uValg.}M+uO[,2̄6T J1WR`ӘnUhͰ\O$C `cj@s+R x*$ӡ>Ԅa$dyON<CrjӤQ뉹0Sl"<J V<?ΙyGD4[mlQ!+=<}ZjtbPU)YMH󰋱\@Wu~%tdTfՉǭjы5g4M͟Dh[4:aўp΢Z |dnTUQA%V-n \7z2t"'J)-Y7:uLP{l?"#cԤ<6w x7&]>*%:[J {^Kʈ{>Ԋ#\bUd&+HZ .(%@@>~%!Dջ"ЕԇMRP ڢ8QΙ|} …C9*>*K>:?%(. S䁃Ǎ$d {,tLQn 8cp>Foz}$GûAǑύV^|Ph]X%ވG^a$IN$@ :\č^V7LTX)I-[vx'L^w<Nrjcf;6I 'q?3vif}4&G|ipGnACpRR#P)*~M\dZAyNQaq+A z@sN;Yp]2gB E9%}K>8*],++(8l|^Mk.)"P% W~ruٟ]?.oH^D(¤5MlBqy[P u}S2NlW0lgB\l$0'%ʯG?N}Hw*E>,exB}(AN&xPORz+LeЃ9!ddRY>^:޽G[)f,"`J -AsδDxUjSqZE`GV7 rQtԞz]Hu/$ۻ|Gԯ˲W/tg4M9 $8s}NOhOd[cTfđOWYlRHޣvRݶyXQ.\ylJp`IBQB?e.$ RR$-Q?QfŌVHt%8qGCzlFYs!KTmy%'̷g9ΝPauoƸk CFӐ2V35SE..uL+$ qIIs>Eu9]:KƚMJAaEq KTsvqnH9hm]yurm }Q]Qcji*` mR@06qX{K}IrY%2t"FTFõ nP '#vqdxTL:+ > TGs`#56Uc]ʚd-eBw;cIf(. ztfl8^zO"0AA$\n* KTqC/D~d +].b:ZBf{اrUIP { l$0tѾT>pV̿#5HQ(;+ +$y&;wq|^fKxh3Ln5!J!j1dZ:}PTN!J\NCMH i]^byV NČ۪iܦsB,Pz"?dH}*ZR\CKN$țD+Qb[+N; %?&=Uk[2^uGe%EʀdNz&f@~,‡BjRSp>Ι7oPddzΩƔjá7F|qi$COird[-Yա]rP[_h°so< mbIx֋WaIa)-[CFHH✜#;+OvHHwd$'JivWn-4RPD!,YJ<pNF;"=2s)[Ǔl<{2)…)$ r3B:Х3O[ bv^ԭ;A( lNcN@V]* Di&/i(;BԠ= JIμV}iT[4N}]=iR0#; Fq9:|.Ϣ[94{4S1IiN=)y sBJgHO#*݇Dv&y5M0oڎ}888]DhA]ڒYp;)85cSv51!|*x!)1҃8R>|p5RnL"&V&Z&TФV6Jʑ8ӂpNm:;W.6:r ٸpsa9ӕRe)NP2(z*HQi{t>-lbE*.AZj-䰴J+eA c QK@Pj I5 Қ(tkjisqu?ΫZ"CP)DwdRÁJ<yI4[y[km=,COF<Jl'9oS1KWuFpSy+Fm8l]۟%UêY*e哜n ' A#MCzGcBgܴ]oBc;1/%Rќ0};gSkѭKOyU}re*dV2 Yb㡷:m*RBTc!p@@?M!vW<ðA.e*HI|e!g"Yh޴+NLIY{[}Ŭh9%-(:w@6)7gkU7mqƝVZTJy'h > yXҀuhJ}M09|gIqէ6TjaT\PZ?vǿ9]guS]ZZwp6T6ʸcێtёNH(5rXQiu(Hg'8HQ xϔʿE|RV$aե) PQie$G9n~[NwRA:Z $1M]@]URt0䔦4 FKT1O:!G9K?ڹ!`&[EmI @]ZYȡ+r& GRq*IR] s?bSj'*,W:ؗR $@?1o^ZS1) ī>GLgvy}W!%Gf֙hɋMJ>[zӹ_zI*$'ܽ+%%Iލ_3LztkڦRڒs$}ST]&{pgZDKCI}䂍-yuLVL7˨qT%Hpu`Zn5O0dhvq_=bŖ.ZCՠRFnujP iY!>+8< :T˕(ҩ{)CTc86݂|y烪MmZ s[̢`CJV ۟sWOor}:۪-<IٽoXKXN1#8j-6C)> g2jӻP6 њe)%岶J}J PUqxShfSnR-SB:HiN6I;NPй jܢOSb<~[g; N)'tHDE6sRg NH*p,($Τh6%̥KyuXTP-gH%Et D8 r3[OjPX:{,YܱPOֲgTdFUr}:/*T'HHQ<c88z1՗"U?gKI[\ިyLl%㜀tBw]3,WMϒ}Tq,xmGr5zv-UzDѢ:vKI2^h]_;BVlPU@) ߸Z>fa:,-մ/! + +[=\zUa};oNdd 3bSI[t=fڧ[0KX+V$8#FNrS I:FZmUX1 ;CG߬թva~cFV}:Pí5/E/C|jl|QX{o)'N j*ʹPAa*.)h؂O85;O}* bPj43soiJ .pֻvYjTX{s>YEqmp֨7dTjU%qGu]=fOJ8e=xDAA@B#(>9.gz$/>@ڣs:W錊ʕ"fZ}m%FK֜Ilwxq4NWhbɶ섎6UoĥIݗtהU,GWY(w|ՇwD lJdɧSu/n)Sn!*@[vmWÝ0-#嫗$ j/i3hrksxHqBFr,xvTtk `3) \'e7 $! v҄Ϝj3zȸ |4/#T~N58[r=8dMӒiQ ! +9-La[CX*`$'nǾ;JM@(:u_?kgЄYn|; StQiU~4|)Ԩm'![ZgzA)* Tfvfr!@ #LZRU*aCʟtAZIڟsMuYʧU~ؕ%8pHAPVzSԷJ؈'!O<:AJM;WL~bVu=͊+8bm5ʮ\rLRUTV@|D5ڒ-Oo,l:IkrLqu-#iK~y$OѬѮߘcʇu;xUizH[1*`CRT9H*8>N:b SS)|XaJlm YXPN*[K{&*K~:V?h(`gӖ\;GҨCiI9-\xR'ort}jvHuj[yuG ~fSXI i|񩆋LΰR^^Zwo7#Gt)/jwMrQ%QO`Áւ +#v}ⷾ7ei6)-|q*T7%{mNˉUBlT-vvR|2H#Ki{$2eNͶ+&DhȈ|x>냪j2l\q,Rd1CڌX(?c-rْ$D9#GQiBcқ}akpzM+5U_&i>z+>3fh׽24f4ʻ_(}ⱹ$jt~) T?v;om mg'g zK~.α%ܻ-s! 8Bo(_I:ȪUm&B ]fO_v=zP g!9C"i\f,eO<7) <8AqYiO/n)RyG `ESO:`!Dv^^cp%{~Op1P*c!ҥiJ'sx (<ηngzvL*Erc[!?bCHB%)OFN)!yH[[JY$gdu[(KzVg O>q'nJA Aq)Ki .>{(zN4*KR[䄉nlRc:qӬF5Pmt)eZZ o8*ʏ/mQ)"Uc;JIX9ǧ yք9U'VN0wxCO4ld2X]xo~2.;dl)PJwdxj/`V\VD4d,۵ HN3_\mAJe<F>yǾGHIf4XiT$IՋꍭ*GL)_i_fu Q$Ϸ#S)u+v<:ݬ$:Pk5W~b<ڈR|TO9'pl+×V)m+MR^ƚK!IXRP}Gv=^Nt &|%tZm/}`W瀮Ogĭ%!\X*_k 1+{ݝ|U5,3Q#9#vHrΧ:u OuUvcq 689ꥷl}aTueRɖfJBq;Ѱ$gH)_SLFpnjp19k-MW"..GEʅ6-~ΗD!Lۖ>U6oT 2^8 )ߏ?MzE1UQLgx&KQZ `P|p~U}Q ROB[H[*VTTFNWO:^=pC`- K? gy=p2-̳[i):n@ SS!CIcxF#KQi-ڮܒNDDM]Cq(ZAV p@UFuotZrhj u(qa ܰ7ptߺ)6~tAKn4maJˌA Sƞ[4[U+OdXI0AH9ҕ!Զ߶oLQi,2ޢiN˥MO-_2Q#.A!L(1x:mAS)]vV 0!7#‘Tz2CQqJ1Ҝ$-I `iԚk4+M7WdJB!rt}+k?H9RӺuD-kqӲ*8gJb5 Op)K(>@ 1+iabu`rbT٘VAg9Vb(%H2c{NpqS_uP$(<`c~y(k&jik&Uiiqt`Ԑn#8iVĴP%ԆyHSͥ{}{G8$#餴ZBH㏦Ko6k9(X'k>55Ji3,>]6"(Hؒ*)Z>θA>y9ĸB4Jm Q=vL U<[LZCTx!ݩ#sG1-Ι{)$QfsՇN}$ny R _o(l &UhȖT2%8UxʉՠEO~p.vNshwfD(ݒ\^|Ȫ :22>Rխwk䙶RPi7*B?iK@Woyw0QV4ؒ.RT1Kn~UfTܛNvKJïA`p ykRvܾ ͵yUS}u)!CsmMj+BZ\TlQZv6H'ҳ$s:jyK%?0H3ym̯ƂR[Oxr <$Hu%% ZFN?=o}d"=A[rbZ1#؟ˍH:ʜdui$ƪ!0+V6IJI]O;uuS4-&]<;B%g2y3F5HF4hFeu:6_W\?Sn(H~.&Yk?W|okO:ֽObwS?K2WGa5:H.5t(q+p6r@2ظY֠2r#.\fm(9 O INh:}*}=j2ࠝT<θf|(ڳ\*1܄ HeEADl^We'%gʔ~%|CY"YT1_Cu@>􀂯}J]"YN9ǗC:J)P~mj7qؔ1*lUeY8mT6>m?Rli~ߓ1ِu \R$d'@vNܠMRW ;-8䡻=DO x޻qTFLX_W$%yNwG2´\wRmsnQڜANsiR궳KOce |x՚f,Sl:Av'A:r2ˈPԤ"GIʒ'Me|UMMriP&uR4Ka*% JddC nZnϊq*{y^T6p=NO]eJ7{mRjLKx,q{W1śTT̲qoӐZ #<sfFN Ǝ' '9 r4n];e.%TYJ%F6e'IΝ_tϩ>R'V܀Zmdž] T{ TBb:_0C @'1:PSk̊ 2[]OMd"R+ mlr>48i:ܢH% #ҢM SKC;C8*%֕ƌ ߷b<`+>S!Xl-0W>s;z%}FK.!ڙm]$ %x>xۍ}/ EO&^;.$<|;I7֯2vb&)l"B&S[ssj_mK8 axH6wEUcI,UxT{(9N-zL)|Dric:x(t9k#hǀ94a7)5|G25[n/m9N$kB=:ަ̔m Z'?HݦK}ODSm܄5$(]mM}_{(t,H+ >O}~VkGT*Tp !^H*: 'EZdWIĐB҂JN8 jP$:z)WnWK'kQ k\~)~Zue(T[_!K5DTe, 90q}m7Õӻ. :]~3*T۲娨繽4[Nm^f)e7 N1TzS咗6 mtpiN2X!ϐ&9@wݏ?:n=2>j=R"BP62x%p^ 2jRwI H\XwrOpDB yu9ɭԮs iuihJԢXX9#zik+TzɪAeAHے(U#J 2pLa4Tvd"͘Q 7 5̓:Aiǔ\%j*YPܽY=U a2%.'RS[bWh4dd'lN6Qv=̓4 f)TmKPtZP qw͑Asfm: էҲFG2~FjmRRϱǃ[C2GktԸV29yvbë-H^99]\)qyV[Xq8chyLE H>x.XE-Hil>R]B’8cǝ:y OHUE K ܐէ SN2* l#>N2r}[pê}B hn=#BG1S}Sʄ~Os%m!gG{ƱvMNPv=J!d7(O$s<2(o^o5mСU CQ %FUd \kiu6J7rOQTK5+ܨ *d^ ǗW*d%*V EҪ -x,nj}zʎyұ-K(/jBE!>&)8l3ʉsR6Npr芛̾ |VTrJߤqr0NHǷ>t&WTKd$#'Nsib;eIW(+Y>_Մ^I+/0l6y{JQDߍ)G%+ cv~~p8{VvҠdSUA8Jy9?]{RvHQ}>ZPJU> ZRu$ r$<~M%@K-!%[$$p+}k;>dli6:PJo Qr[S~ #ӕ6I{kSF3֗jT Ns9%q^R?0$oҳڇ#)g?xM8 #J@CJ% $gFF[}!q d?C65ҏ\9S+i/xx8>t]aڙRBOsېQ]S.6v]KI0=*HZb>m%²x>A?Өh\]_܆RYhpWg!U3?2h-c pu"\lc\) [%miHV}Ӻ4-!ր l g>dBY[ŒFPqmФqm{$5rǩ{>x5̔\ m0$J%RBZTq cjN0 \yӭti%M_8J<9$H'm$#] 5.[mi-zJ<Xǃƺ5YPuj%J`~x4*R_y jT}G> F?>|kRQyRBRNQϱǿa%t v㐜$=ЗS K yA uI첔%K!?,a9%$S#) x2$*,'m*AYR57P2 Hܚ{f>^ pd~>ژTPni(6P_V]xv[S}2JJŞ[\aԇמ<5EMXTI}x?Oic-+;V6B@>,)NvAaԧGd~Zrv~xJ&;,/ <'leFF0~V%ڜX8ӏ^Q) $Kc8Ze 55YsVnva`nd8ƹWI3dD!h_r B_O ݹ| {6c6ILR[N걜!!m@I's$Ǎ{v$I3َKiL\yD*:} $I H*qηvoY5"2<-NZˏ:N56k\&C-֬q mδc@([8r(`y8tD)V$*!?D$dHZr+{54:CliÜJ<jj#=J5ʂʲѰTI!@9>ڑk!-N-wV䓓:rAYI}J8;jYsό}4 Gayyւ 'r}|GZQ.?g\oI7[f[pԕ)Jڒ FR0sqǫ7 I֪3(TJsNv=Jt{$ݯi|`#v[Wq(猓~+R%Ra-O){x=}NK^eiwu!j`}F-R˔TT6̏Q W }4EwR_=ed#~z5Go$p28RZ`ܜ)Y 2n2zlD i+Daɧ "j߉+$(o rtAQj[88^<y'~YH0̙aO' <$4_VNJ -}+(<(i EFh=uiX'cwR8^(RK;P_Ǐ2dǨ͘y)*JVF߮0yvE6esZXwVTyEE4ڔd#+ؕ!"*Bko9(pg H zt!/miLv BS\ke-q֬qA SkRHP#g#FC/O\fHrWhR 'GHLM2xeP)Vx03\:[,)^㺓%'8P裳G;U;nU>1Jt¾r<{ &Sb;JSTKsCQZ8>4\a:ӛ\XfDJU cLBmpm  rG}vLtlHUX{qeANGndECiJ$}^3f ҋ?tv<}j ʔF s>匃:W`Hzrju.q~ RI@I54ӊi1>.}B]IiKǓ2CUw7%oK$n> H)瓮X.Df<9KPTHBZ;qZԄI‡Ƹ.Fjbȋ_+ B Pp~5-JR=W2q3YU*M) q4ܥG@ $r1@ƞTnLp­I /˔v0v}qM*mAH1JTƖmK{ۼzqkخtւXiKRIR' (텶˥ ISJsNkU5JtNm*u BRTV_Tsc5CQD@Mrq(uJ@ $llzSvr@^#HFeuRHO-ÈZP~nv6qάگ$R215oZ&c5c:å˘Kc8>lz\@`M"}:"3|V[q8R><ӯ,5L#zW$Hwd7ĥe(Z9g NOל>"5^kN9>""_U3R}yy*!xQJppI47/SOμ%`>"-PB Jp_yRɸzu97.!cqO9$>tu%ScԬ%Rkز1P2`~񨗨u4C1iG ַT7% <$Xz vfWR\TP1)AC|j=%V:7)Tb (jX)9VR}ܓ\՜r:e%,6khGIxw (-O<̮Y-gFU.铤[*0&+-: mۀnN{=5,ҷ_”KjCjl;yFs>yϧkTwZ)nv# ;]Jqh+Aߖ.6ާ?dI7ZS 1=N!)mŌr? U>+W%WvǢ{o6ط3ˈ )* vRUUKEqyW43tj-%tDŽP`N<~6s%;FƤu^.yL T#&3 QmI\vtĿTW*LyRCSB`åYJ A#5gD)aN P V x IX}:ܳX(̚<_q(cIY* H 5)f :NSg:~eENprvֲ}p|j,:JV , l wQVw5OWkԩh ˪m߸-9>>tZhTPl)n*b)x?O:85`Ֆ Lꃑ …LL-R!2&:”HS~p1EǩQ4MRd5X8Ҹpddx$~Kz]t,b;]K2S211?fڼ:k?5:dkT8P6A35Hԭ$J*#1`۪(A}>Ip!LMʐn네aXW8#u=Z*X.>fda]me`zHW>KWRt7Pq6QZ24݁DimLyN;̲6NH!Y^=Õ)%PiUJEHs zv䁂2kLxͪ{Rd+(m8c>|sWb:MܚT%}07Têvmr4v+bsSn4vwΔq[1j) /4vyI x<}5R2n`2M'u RO eXJ'$c´حU%T(œu4YC{q2*cjjq+m7wNӓ5uW/Ūܑ'.xK+q8J}.%*Q9?5Ei+*2ԛ:C곔wNݨRRsJJ98ԟޠRju6T᧺P㖂@ڝ8uFx\&55Gaii0_S dHWBw@> OTd6:v8GG QRR֦'%*B%\ aKѸLvYm'Z”Bà? 6w,ʬ9T!A+ ܍%)ϸϓJҙ3bXaÊXgtg,$0]PmJیmWx+ƩmΣ- ;nJK/wT=#'ƛ0[bx)e*sm9R98󃭱j1!%} j'i1϶EI!pUm0Z`:JK!*Kx'vN1*C]2_yYHz:ԥ>@;9Ξ.H-ZHO'$kINCe R% 738םAZ2>[J%Kdd-%8@κ*0-hIV0%=%’AOAAGr0I)n JPë5+UIl"!u-!DR<N@ԥ[,eLXZz> 鐘u2IF=5q8҅ɓO>m!|3tS&(I:+ S} [?߁;*ީY4iKMNJT+tJm#o޺B33v'Y%ؙKQi$rcN<󫑺>˶S*)/jۃ#RoLRrbu- xa Kh-*y:T nr۷U;BMꛙikjwX[x)0|k 6]ܦ5RSS+ҔǼ2˯"YBz8! Im'ʳG!2]ܭ̝5nDI(mHHz?;᩷nCjIii}Bi(JJZAN2-t߮xH2m-* AAI`g_@ LmZҽgtޑKJrڠ!S)IŌ'GZ|Oݢ)nÕLy8%8]9 (HqQ)PT :^pAHIqAĺV☏KPn[%G!(eYQ̦}y%.1!L^:ZD"ތQ{# â*+ oei,AJ4d(:`5Wz:%$[r# wEyſur-%N֑QuԪ2*vNOkRJ&uJ$jjA5Q%-+"@%cԠ8)U9_W#ζcVT4*_m Cr)o[T)6-ӣTMKYBR m!/iQIQc NSj}"+.`۳㌾ڑ #>V8=J-JO*S鍏B-ǟKħ9JO8Μ&QSPX/vZ o*; TZQ!9y5λ]O]HS^r\.eKmIwh>9o?{Z&U ]6L$e $)? M:E5D6}-BD57",Yc=# )Mv:%/ImioéE2:}(m䐢JqYϏ:?L#گ͙KDy[EY,*ivw(aYgLYuB=EM"ߔp)n}E'r[q3)ڦc)#Q$>[.OƥJBD9a+zDm'iƣ ťjV*=2ngix>sY=tUz6 %PToF*`6(#@>}y=0(v=(fC7Ӹ`$q??HN+/TiW&[.(؇Kh   -ΣU"O10cK&*ԥ0 $+p}>҄\\ݵ+wԥ.H#s}ժ&pKY.J;c:Ïg'9sֺ/Ok-WᰘpQ%jzS}FJ% *sy LߒZuK؇@NpGJ7"f56U.%h];XTW$*Gʉam6_it2n0T.@m46>x۶v&UmDC)Ee|$%$)G`@ߧ\!D R I qv}yk^4WIRؘiV77% IaC94PYKL|1=[QZ RBWMWt/:%.a ti[6=lFrS4bR|Ħ|qom%I!N"*#ORBLP1 F8jQ؇hK|I? |&Am+ %N$c0ρ3WMvYkMT)-o@q@>JoI>: r$Yqi )nXL%JkihùJ]v몿a@#HN7xҵ \"UĆ>n|TVc8fO9ʒp$ Nn(V TYTEa@.*N+ HxdۍMVTz M4jKt+nIĬsR T8iRt U"=f(dBqĽ@\.t.kiuRKwUOU"<$<) JPPF>4jlΤVeC-˜]m[VR:g$ { ̛KzmP2KFMb,Ĩ8 Hq:>bsɛ/0T)qTrG}metgWY[CEj(JV @QPctݢ6$^_m{¥L>Ä!m;qC>O8zRN. 6ʄ$3LTc))%R s5Tn;e1zdpiU(5wD(2x5`i6z3^EfThLx1{n{(! ;p4ƣU1VV~3*&ƫsʐC)$91*3L-%rOlR-!8$/9mG1cQe4;nCˋRǒ|@*<4~M*ǑJeKN_;>_l$LեtMݲM4^ruOȼcbPO[ki )wuR[O:Y Ԙ {J9 njk-iM&Y2*OV(W_T$IRS0amëID)!䔧PqsUվu3#K*Opi<)N;J s:NeWn]q]lϨapJ@)r|SvEwiŬu RTߦNSkbANUdv/jLfUtdƵaHf ¦SNI)*qJ܏#IP~F[u.RTq[p AԋՆ(=O2EX'q؏SqpRԧTB~QTMnqMbmV")K´,m: IjؿImۂoy4JUFܘf K- tădǢPHMZ!JIF@ ?x $u_>e^}bN]VvߝQr{RC0qZu IXmeX0j5[o[LM=PWEiiIpen'$ 'ƜQpSt!Rܢ h˵b:ܵkPߥ!+Kn壔N|UR%N6CkCyS+eI_17a/ ]M]X5Kԗ";tR0IO6e"dz;dGgwvIS{q>dch5[iSܛ[{5SddTGqequĺ: Tږ}Nrz\lbd[ʕi njjR1tmrO6ZOgNj_Yl(Jj2L`\q[jQ-@I +'*<&.R_5JLzլ$ˡ:zCr )%#HlTNo;UnKB>yB9RB@'HR>6㶍ԱU=uxLRo JeAѵ g5\9QhfmPsgȸx JI'ʆ9Ӣõ:XE)Du-M.ERI9).(G$9svU]*ȦŕCrނ$°Y$r?=i3I\^?1|ɘ\g)#`'ܜtJ_:KhߔiUh=7%I#jC a[ëHҭ$Z:oV8R_UkMSQRR@Pa(`)P9T޺t˧6GwR˼aSj:ʜJ𔤩8RsuZ$ A:m= R)TjqBw<U Nr ycbשFL.Ƙڛy0!![[F2YACB֠E4e sys$g^pjgMa0nf 6>Ъ J_|g8XF(U$qIP@5*I/;)-vx=OINfQXE=Ou 7 m8ZL%ەulUq#).Oq(80uW7HW%Ƨ[߂mYu($sƻV(žpme-$qNI8gӆJB}w:@qҪ[8gY'^Sdio]RGTZAɌ1$ HBwpv㌑MWXQ`BZZr I9>nR36 \c%\cƴ31%$ŜdQlְq5f;NO5*jM`$~ q! \RQP HZKhJq48񬕃bO'k6\GA5' X~UO˄yVpqrr03W.ӧy;}ĴBN3~OT-OAE2S;݆ˎAۊk#8y5 RvV%T)@#>5N``Ӯ%&qP^UD%mAKV*Jy =-*I^W.ib-ee)$4yB |z a}8AQ98q+){s*^S6B𦏱x}5c] ijquƦ {'8#yKG)ld kZՇ 'lj9(M%5 ċr.5F UP^_̡-NINJ$}w"tzT]itB۔gJ>9ΔZڨ$[BA(Ax9±&SrM&cTg(Yo1!9 KT?;pZk4ri)ZYiIRArry=VL:|b?$+vZho@b6TR-IIt-uQ߇05Y A@8b8wՊZW~z- PE#۬rk]om^؅su&Y6Et!)t.)A(?H*W3w^L!Td_B"l']~C :jqRy$ gW'J6t 2lV]%lIHiL:8\ HP8֫áTT*[o&Cso'`@dyQUɓY8R(T;H%DFgzu>HJv_˩\mn8Ϗ6-B}6$WJOe(27N "e%JA{cN#ZVB 8*VU2tHc:'"c=JJO$bץKy,[_/$IB]ajl M)yU&J(qYi-K*CӼ({d >Xf{uߍO?;{Tu@zqj\]mHVk1ܦTc Pu` t1aP e#%Ьe=*u`M,>H%%9nV\Ǜ-GQv"6I҉J<JРκ.msXq"HZÅ8#'g+'.[ퟲܒ^uZDu )aCQ|tҿpPtZnUJ[<q1wd52( %efQU6Q O5! m)QScM>ߔȍqG7[SuTSPNFs>554ۨ;Bniq.@(>xe;bOnTc )nβbRm*v4jx' uUQR۾t[Ek[P! TXvqӆ!.[Q9@B3<ꈎѪPASPۡi:8Vfж)[Z"PhS0Ga)q)%jܖϩłT(*'ԭCUaMRJRh!'N0sL]2֚{@k7ag(|yLib586RAAn$sJ4ۆ L,,:[,S{6T~ҕmnqY/G}$䅓pFuSsԉ\L=nR|TnlcO H_^(ɤYUU.R豝vZeV-?vdvu^z!nu $RZf,IeH._ܟW*ۏV>5ʅ5]{ eP]m[W:*#jkne HJrS4$|`yʰqōj۟8CTJԕ- %I$ F u'@DCfښZ BӀKkPIP$>n-xnHj kԬYO*d^ZZa $$V!BGoۯ1iFפk+R}#$LA(Z?\O{s#\Ri,HHVl˵enSGaIS8'hƽ#w P. ta69_>r?CHtޥƕO]5dSIeXa)J((sإh JADZ5;HGU蝻\L~].*!Iݺ:ÈNsEPc.ĉW5.8RY)9qpYpn&\g,mN bƒR$x&ث;e[ڇ?Mv~-5p~z}~]"2^6Lܩ.3h;@O@(,( ?.u Nzi }YR|z[h՚4nĪ5mǩÐ{$J֐IL usZJ]/TJ̥m** %$G#ꧫ4瞧%R1sRI>MwvH[bTJ钿 ߴ?jYy3+{s:ÛHܜiӳHsYHC(κ*n?_,5wRuPP% m9r]+r2T*hQ8Ygb%ǎNl)U$D5j*P"WVgvP g>4&U>et dPf5 `43}2IڧP*4dy>A?M]*eJ5^!1_Hq9J|uY2vE/^~SE8y)Q ޤ3驾ebyo?$IC⇢e~R)w%˭#Hw I;H?~j'Q_:$Ēq'$_L:_*: LRciͥNp70 Qλuk\:z bͨ(08l! ߓ8#O=4kΚȇF4hѠF4 umԿLPKQ[K_,W\M_.&N+_k?(|+kukz'-Nd< oZ?Xi#Ϣ\Aڣ{7